Q: What is the map distance between the two rapid lysis mutations re and r' given the data below? 2…
A: In the question given that, re- rf- X r+ Large plaques= 5200 Small Plaques= 4800 Out of the total…
Q: You observe the following: Your Your friend's Gel Gel 120 kDa 100 kDa 120 kDa 100 kDa -80 kDa 80 kDa…
A: you have asked multiple question please repost the question and mention the sub parts needed to be…
Q: If the heavy chain of an antibody is approximately 450 amino acids long, how much DNA would be…
A: In this question we are asked that how much DN A may be possibly required to encode 10^0 split heavy…
Q: What is the purpose of sheep red blood cells in the Paul Bunnell Davidsohn test?
A: Paul Bunnell Davidsohn test is used to screen infectious mononucleosis. It is caused by Epstein Barr…
Q: The disorder hypogammaglobulinemia is characterized by a decrease in the secretion of one or more…
A: BASIC INFORMATION IMMUNE SYSTEM It defends our body from the foreign particles which can cause…
Q: In the Western blot shown here, proteins were isolated from redblood cells and muscle cells from two…
A: Thalassemia is a blood disorder passed down through families (inherited) in which the body makes an…
Q: You are counting plaques on your plaque assay plates made from serial dilutions of your high titer…
A: A serial dilution is any dilution in which the concentration decreases by the same dilutions in each…
Q: Which of the following recombinations is not permitted during somatic recombination in the…
A: In immunoglobulins, VDJ recombination is the mechanism of somatic recombination that occurs only in…
Q: What is the purpose of blocking the Western Blot membrane? A) To cover the membrane with a solution…
A: Western blotting is a commonly used analytical technique used to detect specific proteins in the…
Q: Figure 3 presents the results of the MTS assay and expresses the results of the cell survival as a…
A: The MTS assay is a type of assay that is used to measure cell proliferation, cell viability and…
Q: In the SARS-CoV-2 assay, what is the benefit of a diagnostic tool that can distinguish the…
A: The novel Coronavirus infection SARS CoV 2 can be diagnosed by different means. Proper diagnosis,…
Q: Borrelia hermsii is a spirochete bacterium, transmitted by tick bites, that causes an illness…
A: Immune system is system which helps our body to fight against the foreign substances which will…
Q: Rarely, the conjugation of Hfr and F− cells produces two Hfr cells. Explain how this event takes…
A: The conjugation is the process of transfer of DNA from one donor bacterium to a recipient bacterium.…
Q: An enzyme is known to transport lactose into the cell. Answer: Mutations in CFTR gene can cause O a.…
A: Introduction: Enzymes are proteins that serve as biocatalysts. They enhance the rate of reactions…
Q: In an experiment assay, sometimes there are several dilutions involved. 0.5 mL of (Bovine serum…
A: Dilution is responsible for decreasing the solute concentration in the solution.
Q: What is the purpose of washing a western blot membrane with TBST after the primary antibody binding…
A: Question -What is the purpose of washing a western blot membrane with TBST after the primary…
Q: rom the MW analysis; are any of the gel and immune-detected bands consistent with what you expect…
A: please post questions separately. Answer 1: From the MW Analysis : any of the gel and immune…
Q: A/Texas/04/2009 WJ379 Oseltamivir carboxylate 1 μΜ No Drug 3 nM 1 μΜ 10 nM 30 nM 100 nM 300 nM 3 µM…
A: This is a plaque assay with human lung epithelial cell to compare the effectiveness of two drugs…
Q: Using PEN and PAPER ONLY, illustrate a SARS-CoV-2 genome organization showing all the genes. Label…
A: SARS-CoV 2 is a virus that affects several organs in humans like the heart, kidneys, and very…
Q: Why does an Hfr * F- mating not yield two Hfr cells?
A: Conjugation is the process of genetic material transfer between two bacterial cells through direct…
Q: The figures 1 and 2 show the agarose- gel electrophoresis pattern of the serum proteins of a healthy…
A: Serum Serum is the yellowish that is remains from blood plasma after the removal of clotting…
Q: A student conducted an experiment on protein isolation from mungbean. After isolating the protein,…
A: Bradford assay is an example for a general protein assay. It is used to quantify the unknown amount…
Q: Humanized monoclonal antibodies are best described as a. antibodies made in mice in which the…
A: Ans: The antibodies generated in the laboratory that specifically binds to single epitope or antigen…
Q: Which of the following represents the correct order of experimental steps for the Western Blot? A)…
A: Western blot is an analytical technique to identify the presence of a specific protein within a…
Q: The figure below shows the structures of the blood group antigens O, A and B.List all nucleotide…
A: The ABO blood group is an example of multiple alleles in which total three alleles are responsible…
Q: Several cell culture lines of epithelial cells, called “Cell Line A, B, or C,” are incubated with…
A: Epithelial cells are present on the surfaces and line the inner surface of the body, such as the…
Q: why would there be some additional bands on an immunoblot that do not match the molecular weight of…
A: Immunoblot or western blot is a technique where we can detect the presence of a particular protein…
Q: Provide a description of the events in each transition for the F factor: a. F- to F+ b. F+ to Hfr…
A: Hey, since there are multiple questions posted, only first question is answered. If you want any…
Q: A student conducted an experiment on protein isolation from mungbean. After isolating the protein,…
A: Protein is an amino acid-based macromolecule that plays a crucial role in the body. Amino acids,…
Q: Explain how each of the following processes contributes to antibody diversity. a. Somatic…
A: Antibodies or immunoglobulin is a protein that is protective in nature and is secreted by the immune…
Q: What is the map distance between the two rapid lysis mutations re and rf given the data below? 2…
A: Hint: Always less numbered progeny becomes recombinants. In the question given that, re- rf- X r+…
Q: In the next experiment, MCF-7 cells were treated or not with indibulin and the effect of this drug…
A: Question: Comment Figure 4 globally (make the parallel between the left images and the graph on…
Q: About the three following diseases: phenylketonuria (PKU), sever combined immuno-deficiency (SCID),…
A: A disease is a condition of an abnormal structure or function of any part or organ of the body. It…
Q: Have a look at the results in this SDS-PAGE gel. A MW ladder is shown. In the "control" lane, a…
A: In analysis of gel electrophoresis data, the band represents qualitative data, i.e. whether the…
Q: If you wanted to test the effect of a 1:2000 dilution (2,000-fold) of lemon juice on PtK2 cells, how…
A: The formula for calculating a dilution is (C1) (V1) = (C2) (V2) where,1/ C1 is the concentration of…
Q: Imagine after completing all steps for western blotting you see that your membrane is FULL of dark…
A: A secondary Antibody tagged with some fluorophore is used to provide fluorescence and detection of…
Q: a student uses a monoclonal antibody to detect a protein using a direct Western-blotting protocol…
A: Secondary antibodies are used to detect a target after a particular primary antibody has been bound…
Q: Certain naphthalene derivatives, such as the dansyl group, exhibit a weak yellow fluorescence when…
A: Dansyl chloride is a reagent that reacts with primary amino groups in both aliphatic and aromatic…
Q: In a particular species, the gene for the kappa light chain has 200 V segments and 4 J segments. In…
A: Immune system protects the body against infection. It is a complex network of cells and proteins.…
Q: During site-specific recombination that occurs in an antibodygene, the protein(s) that catalyze(s)…
A: Introduction:- Site specific recombination is an exchange that occurs between pairs of defined…
Q: How many diff erent heavy chain variable regions can theoretically be generated by somatic…
A: Somatic recombination is a recombination process where immune cells (B, T) of the adaptive immune…
Q: Why might it be necessary to include the 50 mL cultures in order to express protein? This question…
A: Hi, First I would like to thank for submitting the question. The question has one error as the word…
Q: How can we easily determine VEGF expression in a western blot experiment? By using fluorescent…
A: VEGF (Vascular Endothelial Growth Factor) is a highly potent angiogenic factor that plays a key role…
Q: antibodies were produced in a rabbit against a 25 KDa human soluble protien. when the rabbit…
A: In western blotting, the target protein is recognized by a synthetic antibody, called a primary…
Q: Knockout mice are mice in which certain genes are rendered irreversibly nonfunctional through the…
A: The knockout mouse has been a valuable tool for geneticists to discern the role of a gene in…
Q: Western
A: In the first step their is answer of first four molecules as follows:
Q: In the following experiment, strain B mouse is subjected to sublethal irradiation and a bone marrow…
A: Innate and adaptive immune responses are characteristics of the immune system. The immune system's…
This is an SDS-PAGE of an antibody purification sample with IgG seperated from a Bovine Calf serum. Would you be able to describe the bands that are appearing and why it appeared on the gel this way? As well, a western blot was done after the SDS-PAGE and the bands that appeared were at 50 kDa and 150 kDa for the IgG and two elution lanes. May you please explain?
Step by step
Solved in 2 steps
- 250- 1 2 3 4 5 6 -250 150- -150 100- -100 75- -75 50- 37- 25- 20- 15- 10 10- Std Biorad BSA Calf serum Fibrinogen Std Biorad Transferrin 161-0318 161-0374 -50 -37 -25 -20 15 10 2. Measure the distance (in mm) moved for each protein standard band and record in Table3.6 below. Table 3.6 Example of table for recording of data - measured distance moved and calculated Rr values Item Band Distance moved (mm) Rf Log 10 Mr (from graph) Calculated Mr (antilog of the previous column) Sample C Band 1 Sample F Band 1 Band 2 Sample B Band 1 Band 2 Sample T Band 1Based on the image below, select the correct statement. Complex II QH₂ Q- 10 2 HO 2 HO Fe-S (2.8 FADH₂ FAD- Succinate Fumarate https://canvas.uts.edu.au/assessment questions/356986/files/1562694/download? 2e verifier-eUTT3hYal2YYTWlywV8TIFA3USmzCsM52jECmvTo O Succinate is reduced to fumarate O Succinate is oxidised to FAD O The Fe-S center shuffles electrons from FAD to ubiquinone (Q) O The Fe-S center shuffles electrons from FADH2 to ubiquinone (Q) The Fe-S center shuffles electrons from FADH2 to ubiquinonol (QH2) W 88 16°C11 Ⓡ The tissue type that is shown in this image is Saved LM 1000x Be as specific as possible. +
- EcoRI 4359 Aatll - Zral 4284 Bei 4209 BsrBl 4205 Clal - BspDI 23 Hindill 29 EcoRV 185 Bmtl - Nhel 229 Sspl 4168 Earl 4155 Acul 4048 Xmnl 3961 Hincll 3905 Scal 3844 BamH 375 Sgrl 409 Banll 471 Banll 485 Вы 3787 Bsl 3759 Bgl 528 Sphl 562 EcoNI 622 Sal - Acct - Hincll 651 Pvul 3733 Pstl 3607 Bartl 3602 Pshl 712 Asel 3537 Eagl 909 Bell 949 Bsal 3433 BarDI 3420 Nrul 972 PBR322 4,361 bp BstAPI 1045 Ahdi 3361 BspMI - Bfual 1063 PAMI 1315 Bsml 1353 PAMI 1364 Acul 3000 Ori Styl 1369 Aval - BsoBl 1425 PpuMI 1438 Msel 1444 Bigl 1447 Ppu 1480 AlwNI 2884 Bell 2777 kI 2682 rop Drdi 2575 Bsgl 1650 BspEI 1664 Pcil - Afl 2473 rBl 2404 Earl 2351 Bspol - Sapl 2350 Ndel 2295 BstAPI 2291 Bsaß 1668 Xmat 2029 Pvull 2064 BsmBI 2122 Dndl 2162 BstZ171 - Acct 2244 Bsal 2225 TthI- PI 2217 Figure 1 If your gene of interest was inserted at the Sphl restriction site of the plasmid illustrated in Figure 1, describe the screening process to select the positive recombinants.in Course: 23SPCMP Anat & Phys... The tissue type that is indicated by the black line is @ # M Question 32 - Lab Practical 1 -... $ % LM 320x 4+Ad 1 of 2 · 0:01 lazada.com.ph/ Ad will end in 2 ---- 1. Make a summary table of the 3 sections of theprimitive gut tube, indicating the blood supply andthe adult derivatives of each section 2. Describe the following congenital anomaliesinvolving the digestive system: a. Esophageal atresiab. Malrotations of the midgutc. Imperforate anus 3. Briefly discuss the pharyngeal pouches and their derivatives. 4. Summarize the 5 stages of fetal lungdevelopment 5. Briefly discuss the role of pulmonary surfactant inneonatal adaptation.
- orY i 8 < Bilirubin is converted from unconjugated into conjugated before entering the liver. False O True O dilayl haaWhat is the difference between Graves disease and Cushing disease? +66-t=449595&cmid=1668389 textb... My ATI NOLOGY SUPPORT ✓ MTH 208-01 (MW... K Kaplan Login WP WileyPLUS VitalSource Books... Zika virus is chiefly spread using an insect vector, more specifically, mosquitoes. Given this, which of the following helps account for why all blood donations in J.S. are screened for Zika? O a. Zika can be easily transmitted from person to person even through incidental contact O b. Zika infections are now common and regularly reported in every U.S. State (except Alaska) O c. Screening of blood donations is the main way in which Zika infections are diagnosed in the U.S. O d. Climate change extends the habitat of mosquitoes that can carry the virus Next page
- Chest x-rays give the lowest doses. Why?A- B ↑ ↑ C- An image of a hematocrit blood test is shown. Indicate which layer refers to the buffy coat. A B Ос1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate V