1. Identify the type of chromosome mutation portrayed by the illustrations that follow. The mutation shown here: [[3] II. Take a look at the illustration below: 5 4 A 2 9 в 7 8 What Viral cycle is being described by A? What viral cycle is being described by B? III. Class of Viruses G-0. 1.
Q: Why is tooth structure important in the study of mammals
A: Mammals are heterodont, that implies they have a variety of teeth that serve specialised or distinct…
Q: 49. The hip joint is formed by the articulation of the of the_ to the which is the socket on the…
A: Introduction Joints:- Joints are where two bones meet to allow movement, it makes the skeleton…
Q: Compare the bacterial cell wall in gram-positive and gram-negative bacteria.
A: Introduction :- Peptidoglycan, an essential protective barrier for bacterial cells that encases the…
Q: Penicillin obtained from a fungus is : A. Antibiotic B. Antiseptic C. Antibody D. Antiserum
A: Introduction - Medicine is the science and practise of caring for a patient, including diagnosing,…
Q: Surgical method of sterilization in a woman involves cutting and tying of: A. Ureter B. Uterus C…
A: Tubal ligation is a surgical operation that involves cutting or sealing the fallopian tubes. Having…
Q: Order the path of light through the eye. Question 68 options: retina lens cornea…
A: The path of light through the eye begins with the objects viewed and how they produce, reflect or…
Q: Hb oxygen binding capacity
A: Hemoglobin : Then red protein responsible for transporting oxygen in the blood of vertebrates. its…
Q: How can the variability of life in both time and space be described?
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…
A: Defination of the gene :-
Q: e following? ement of ions and smal gh concentration. of f energy from ATP to . ey are in lower…
A: Cell transport- The movement of material cross the cell membrane is refers as the cell transport.…
Q: You will be visualizing fluorescently labelled clathrin in this lab. How is the clathrin labelled…
A: Clathrin is a protein that plays a major role in the formation of coated vesicle . this term was…
Q: Hello! Talk about the lecanemab and solanezumab treatments towards Alzheimer's diseases. It is…
A: Alzheimer's disease- is a neurodegenerative disease that has a slow start and worsens progressively.…
Q: b. As we have learned, the HbA1C glycosylation event occurs non-enzymatically in the body. HBA1C…
A: HbA-HbA is the most common type of hemoglobin which is present in red blood cells It is also known…
Q: Which enzyme can recognize an altered base in the DNA? Group of answer choices DNA Polymerase AP…
A: There are several DNA repair mechanisms are present that are- direct repair system, excision repair…
Q: three different types of loss of function mutations and in each case explain how the mutation exerts…
A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…
Q: make glucose and the oxygen is released as molecular oxygen. If you do the math how much…
A: In photosynthesis green plants use energy from sunlight to convert atmospheric carbon dioxide and…
Q: Cell membranes can maintain a difference in electrical charge between the inte- rior of the cell and…
A: Cell membrane is negatively charged from inside in comparison to outside. But at the time of impulse…
Q: Which type of mutation involves only one base pair? a. insertion b. deletion c. inversion d.…
A: A mutation occurs when DNA molecules are copied or replicated, resulting in DNA variants that can be…
Q: What are the negative effects of Communicatioon Technology to agriculture
A: Agriculture nowadays has improved a lot due to the development of new technologies like tractors,…
Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…
A: DNA replication is the process of reproducing a double-stranded DNA molecule into two identical DNA…
Q: Genetic Crosses that Involve 2 Traits In rabbits, black hair is dominant to brown hair. Also in…
A: The Punnett square is a square design which is utilised to forecast genotypes in a cross or breeding…
Q: reproductive
A: Turtle- It is an reptile belongs to order Testudines. these are mainly characterized by a shell…
Q: Which statement describes the most likely outcome for the owl and toad populations in an environment…
A: skyglow causesthe owl population to experience a decrease in hunting success it can be explained by…
Q: f. If Lamarck and Darwin had debated why giraffes have such long necks, how would their explanations…
A: Lamarck He proposed the theory that the physical changes in organisms that took place during their…
Q: Marine fish when placed in tap water bursts because of: A. Endosmosis B. Exosmosis C. Diffusion D.…
A: Introduction - Fish that dwell in seawater are known as saltwater fish, marine fish, or sea fish.…
Q: About the three following diseases: phenylketonuria (PKU), sever combined immuno-deficiency (SCID),…
A: it is an inborn error of metabolism due to deficiency of phenylalanine hydroxylase which converts…
Q: what plant process involved in your experiment in transpiration in colored rose aside from…
A: The plant body is complex, made up of several systems. Each system in the body has a distinct…
Q: . Briefly explain the mechanism of gene flow.
A: Gene flow is also known as gene migration. The transfer of genetic information from one population…
Q: 1. Explain why the homologous structures in part I are evidence of evolutionary relationships.
A: The figures that are shown in Part I are structures of homologous organs. These are the structure of…
Q: Lymphoid organs are divided into primary and secondary peripheral organs. Briefly describe thymus…
A: The primary lymphoid organs are the red bone marrow, wherein blood and immune cells are produced and…
Q: Describe the key characteristics that would allow you to identify or differentiate diatoms, green…
A: A microorganism that can only be seen under a microscope. Bacteria, fungi, algae, and protozoa are…
Q: Explain the evolutionary relationship between the fin of a fish and the flipper of a whale.
A:
Q: Question 34 The diarrhea (loose and watery stool) that is a symptom of diseases like cholera is due…
A: Gallbladder is basically associated with digestive system and helpful in storing the bile juice…
Q: Justify why algal biotechnology has the potential to be the future of climate change mitigation
A: Algae can help combat climate changes by removing CO2 from the atmosphere, storing it as biomass,…
Q: Order the following events that occur during a nerve impulse. a few milliseconds behind the Na…
A: Order of nerve impulse events are :-
Q: Which of the following gene expression regulatory mechanisms saves the most energy but takes the…
A: Gene regulation expression defines a wide range of molecular mechanisms, that are used by the cell…
Q: Match the male structures with their descriptions. a collection of tissues that allows for…
A: 1) Testes: Tissue that house many cell types that are responsible for sperm manufacture and sex…
Q: A.Hawaiian honeycreepers tend to have long and slender beaks to obtain the nectar of the flower…
A: The natural selection is the process by which the organisms are selected in the nature depending on…
Q: Recall how Anolis carolinensis species on several islands off the Florida coast adapted to the…
A: Anolis lizards have In 15 years, these lizards' toe pads have become larger, with more sticky scales…
Q: What were the two major goals of the Human Genome Project? Select all that apply. a to isolate…
A: Introduction :- The Human Genome Project was an international scientific research project aimed at…
Q: Jaundice (turning yellow) can occur with newborns and also in someone with hepatitis
A: Answer :: Jaundice is a condition that includes a change in the color of the skin, whites of the…
Q: When does crossing over happen in chromosomes? O Meiosis Prophase O Meiosis metaphase O Mitosis…
A: Cell division is the means of reproduction in unicellular (single-celled) organisms, whereas in…
Q: In a wright fisher population, with population of 99 only has AA individuals. However, in a one…
A: Given data:- 99 people have allele = AA 1 people migrated in this population with genotype = aa.…
Q: Match the STD with their descriptions. Question 24 options: leading cause of PID; bacteria…
A:
Q: What is the starting point of all research in genomics? a out-of-Africa theory b PCR c gene…
A: The branch of Biology that deals with the study of the structure, function and other attributes of…
Q: If the relative fitness of the A,A, genotype is 0.8, A,Ayis 1.0 and AA is 0.6, what is the mean…
A: Introduction In the absence of other evolutionary factors, the Hardy–Weinberg principle, also known…
Q: Give 4 causes of crystal formation in a synovial fluid. V. Name the tests and storage of the 3…
A: Synovial fluid, also known as joint fluid, is a thick liquid located between your joints.
Q: different
A: Xenobiotics are the chemical substances present in the animal body which not found naturally in…
Q: Glucose in urine is an indication of all of the following, except blood glucose levels are high Tm…
A: Glycosuria It is a condition in which a person's urine contains more sugar, or glucose, than it…
Q: Figure la and 1b show two protein gels (SDS-PAGE) in which human blood serum has been…
A: Although many conditions can cause an increase in the gamma region, several disease states cause a…
can you help me? pls
Step by step
Solved in 2 steps
- Syn5 is a virus that infects photosynthetic bacteria belonging to the genus Synechococcus. The Syn5 virion is icosahedral (660 Å in diameter) with a short tail and an appendage called a horn. The horn is located on a vertex directly opposite the tail. Syn5 follows the typical five steps observed for most viruses when they multiply, and progeny viruses are released when the host lyses. The assembly of Syn5 virions involves several proteins, including capsid proteins, scaffolding proteins, a portal protein, a terminase, tail proteins, and horn proteins. To better understand the assembly of Syn5 virions, scientists used a type of microscopy called Zernike phase contrast electron cryotomography. This type of microscopy improves the contrast typically seen for conventional cryotomography. In their studies, the scientists observed several different developing virus particles in infected cells. The particles were: (1) 660 Å icosahedron containing DNA and having a tail; (2) 660 Å icosahedron…To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…Coronaviruses have a positive-sense single stranded RNA genome. a.) What is the genome replication strategy of this category of viruses? b.) How do you think this feature affects the stability of the viral genome? (hint use figure below) Mutation rates in different types of viruses. Estimates obtained for viruses belonging to the major indicated groups are shown as a function of genome size. This reveals an effect of genetic material (RNA/DNA) and genome size on viral mutation rates.
- 1. "One structural form used in building virus particles is based on the icosahedron. Describe, either in words or in a diagram, the organization (number of capsomers, etc.) of the simplest virus particle of this form. 2. If a virus has a negative‐sense RNA genome, what enzymatic activity (if any) will be found as part of the virion, and what will be the first step in expression of the viral genome?"Name a nucleoside analog. Explain how that nucleoside analog works. Which viruses are effectively treated by that nucleoside analog?The dUTPase enzyme is used by the African swine fever virus to repair its own DNA, as the cells the virus infects in swine do not express the dUTPase protein. Which of the following is a reasonable explanation for the role of the dUTPase in the virus lifecycle? Explain your choice in 25 words or less. The dUTPase is necessary to remove dUTP from the viral genome, as uracil should not be present in DNA The dUTPase is necessary to remove dUTP from the viral genome, as uridine cannot correctly base pair with adenine-containing bases The dUTPase is necessary to remove dUTP from the viral genome, as uridine has the wrong sugar component for building DNA More than one of the above answers is correct None of the above answers is correct
- Some retroviruses that have a wide host range have been developed for use in treatment of diseases or syndromes. These viruses do not result in a productive infection because they lack critical genes for viral replication, but they do carry DNA sequences that allow them to be packaged into infectious particles. Once in the host cell the viral DNA is released and integrates into the cell's genome. The advantage to this strategy is that the delivery of the DNA is very efficient. What is one possible problem of using a virus that can integrate into the human nuclear genome? Multiple Choice The virus carries genes that will interfere with host cell activities. The viral DNA sequences could still cause a disease. Since the viral DNA sequences no longer contain essential genes for viral replication the host cell may not be able to replicate either. The integration could disrupt an essential gene or genes.OF rasc PDF Teas fill Which of the following is NOT a step in the replication of a retrovirus? A diagram illustrating the process is provided below. PDF UNOFFIC TRANSCR 59°F Mostly cloudy Virus Viral RNA Reverse transcriptase DDDDDD ↓Viral DNA Provirus mRNA mm Proteins mn Viral RNA Protease Plasma membrane Host DNA New virus O The single-stranded DNA forms a double-stranded DNA called a provirus, which is incorporated into the host cell DNA. O After a retrovirus attaches to the host cell, it injects its viral DNA and uses the host cell's machinery and materials to replicate. O After a retrovirus injects its viral RNA into a host cell, it forms a DNA strand by reverse transcription. O When the host cell replicates, a provirus produces the viral RNA needed to produce more virus particles. P O Search hun recc PDF maste omissCan you please pick the right answer in each parentheses? The spike protein of SARS-CoV-2 is a carbohydrate-modified protein that ["bind the RNA genome of the virus", "", "is on the surface of the viral particle", ""] and plays a role in both ["replication of the viral genome", "recognition of host cell"] and ["packaging of viral genome for export", "fusion of viral envelope with host cell plasma membrane"] . Importantly, earlier work on spike proteins from other corona viruses showed that this molecule ["remarkable resistance to immune response", "shows remarkable conformational changes"] and only one of these served as a good antigen for vaccine development. A critical discovery in advancing the development of our current vaccines was determining what changes in the amino acid sequence would ["block degradation of the spike protein", "stabilize the conformation of the protein found on the viral particle"]. This…
- Given that viruses must be cultivated to make vaccines against viral diseases, discuss the advantages and disadvantages that might occur with each approach (embryonated egg versus cell culture) to growing animal viruses.Bacteria exposed to viruses incorporate sections of the virus’s DNA into the CRISPR array sequences in their genome. This mechanism allows bacteria to fight off the viruses, like an immune response: the information in CRISPR spacers served as “coordinates” for recognizing and cutting up invading DNA sequences. Describe what might happen under the conditions described after a bacteriophage infects a bacterial cell and releases its DNA into the bacterial cell. Explain why: 1. The invading phage DNA is recognized by the Cas proteins but not inserted into the CRISPR array region of the bacterial genome: The bacteria will be unable to elicit an immune response and will succumb to the phase infection 2. The cas genes on the bacterial genome contains a missense mutation that increases its cleavage/cut activityThe bacteria will elicit an immune response that will successfully fight the phage infectionSome DNA vaccines use a brief and small electrical shock to get DNA in plasmids into cells. What advantage would there be in using DNA vaccines that consist of plasmids instead of just pieces of double-stranded DNA? The new Covid19 vaccine produced by two companies (Pfizer, Moderna) uses mRNA coding for part of the spike protein of the virus. The virus uses the spike protein to invade human cells where it replicates. Is it surprising that the mRNA must be stabilized with chemicals that need ultra-cold or frozen storage to protect the mRNA from degradation before it causes human muscle cells to make the spike protein? Why not just inject the double-stranded cDNA that codes for the spike protein of the virus? What additional step or steps would you need to use to get the human muscle cells to produce the spike protein if the cDNA was injected to serve as the virus?