Q: It might be easier to catch a snake in the early morning, compared to night. Why?
A: Snakes belong to the class reptilia of the animal kingdom. These animals crawl and most reptiles…
Q: It will be more difficult for the student’s neurons to generate action potentials The student’s…
A: Tetrodotoxin is a sodium channel blocker that also prevents the firing of action potential in…
Q: What does the term “binomial nomenclature” mean? What does it consist of?
A: The concept of binomial nomenclature was given by Carolus Linnaeus. He gave this concept in Species…
Q: Look for recent (2017 to 2022) scientific papers, stories, or features that demonstrate the use of…
A: Spectroscopy is an analytical method that is used for the detection of unknown compounds. In the…
Q: Explain what would happen to the processes of protein synthesis if a molecule blocked the A-site of…
A: The protein synthesis is known as translation that involves production of polypeptide chain from the…
Q: he mammalian ____________ evolved 520 mya and the _________ developed 200 mya. a. midbrain,…
A: The theory of evolution explains the history of life on Earth and how biological populations have…
Q: components of the bronchial tree. Region of Bronchial tree Primary Bronchi Secondary Bronchi…
A: 1) Primary Bronchi Epithelial Tissue- Pseudostratified columnar ciliated epithelium. Cartilage- Yes…
Q: The Camelia flower exhibits codominance with flowers being red, white, or white and red spotted.…
A: Codominance condition is a condition in which both the alleles lack the dominant recessive…
Q: on the future of the planet— SHOULD our food preferences change? Support your answer with facts from…
A: you asked the multiple question, i will solve the first question for you. If you want any specific…
Q: 8. Name the six classes of enzymes and type of reaction envolve.
A: Note: As per guidelines we can solve one question at a time.ask rest questions to get answer!!…
Q: Chlorophyll is the dominant pigment in photosynthetic cells, and degrades earlier than carotenoids…
A: Chlorophyll is the dominant pigment in photosynthetic cells. and degrades earlier than carotenoids…
Q: Whyte type canaries are yelllow. A dominant mutant allel of the color gene, designated W causes…
A: Introduction :- A genetic disease manifests in autosomal recessive inheritance when one variant is…
Q: Coenzymes function to: change the shape of enzymes, allowing different additional substrates to…
A: Introduction :- Many enzymes need coenzymes, which are organic substances, for catalytic activity.…
Q: What is the importance of using freshly prepared KOH in testing the bacteria? Explain this…
A: During the twentieth century, most microorganisms were found and researched in labs. However,…
Q: 41.A55-year-old womanhasaneoplasmoftheanterior bodyofthe uterus.Which of the following structures is…
A: An abnormal development of tissue known as a neoplasm can be benign or malignant. The majority of…
Q: give the types of gamets produced by a plant with round seeds and yellow cotyledons and gentype RrYy
A: Introduction The type of variant present at a specific locus (i.e., region) in the genome is…
Q: If a disease instead killed 50 percent of females how might this affext the popilation grouth raate?
A: introduction The country, territory, or geographic area's yearly average rate of change in…
Q: (1) Give 3 differences between DNA and RNA (2) Give 2 similarities and 2 differences between…
A: 1) DNA and RNA DNA RNA It is the hereditary and genetic material of cells It is involved in…
Q: H Н Н H
A: A tetranucleotide is a DNA fragment sequence having four bases. The answers to the question are…
Q: Suggest TWO (2) commonly available biomass in Malaysia that can be utilized as potential feedstocks…
A: Malaysia has a very potential for biomass energy uthilization. Its equitorial climate that is ideal…
Q: explain what can be the future developments of curing adenocarcinoma tumours in regard to (colon)…
A: A group of benign (noncancerous) cells collectively known as an adenomatous polyp is the primary…
Q: Shown in Appendix 1 is an example of a general-purpose cloning vector. A typical plasmid/vector map…
A: ORI site: The arrow in which ori is written is the Origin of Replication (Ori) site. Origin of…
Q: a pa aryotic cel diameter of 2.7um and a particular spherically-shaped eukaryotic cell has a diame…
A: Prokaryotic cells are smaller than eukaryotic cells. Prokaryotic cells have simpler organisation in…
Q: provide a detail analyses of the disease adenocarcinoma in regards to bowel cancer. (colon/rectum)
A: The most common type of colorectal cancer is adenocarcinoma. Adenocarcinoma of the colon and rectum…
Q: Based on this information please state the IV= DV= Controlled= control group = experimental…
A: Independence variable is the cause and dependent variable is the effect. The dependent variable is…
Q: Take a deep breath and relax. The oxygen that you breathe in is directly consumed by the _____ in…
A: The electron transport chain is a step in the aerobic respiration. It produces ATP by oxidative…
Q: Which of the following statements are true regarding homologous pairs of chromosomes? Select all…
A: Introduction :- The term "homologous chromosomes" refers to chromosome pairs that have genes for the…
Q: 1. A point mutation occured at base 6 in the original DNA, provide the amino acid seuence and the…
A: Any detectable, inheritable qualitative or quantitative changes in genetic material of an organism…
Q: You are studying a population of 1000 skunks (which are diploid). You sample alleles at two genetic…
A: Given information There are 1000 skunks that are diploid. A gene has two alleles A and a which are…
Q: Which of the following is NOT a role for tissue-residebnt macrophages in maintaining homeostasis?…
A: Answer: Macrophages carry out crucial tissue-specific tasks and defend the organism from infection,…
Q: Total bacterial count includes both living and dead bacterial cells. true false
A: The total bacterial count and the total viable bacterial count is used to analyze the hygienic…
Q: photosynthesis and respiration
A: Photosynthesis: It is defined as the process by which plants use sunlight, water, and carbon…
Q: 9) The accompanying pedigree is for a rare, but relatively mild, hereditary disorder of the skin. 1…
A: Inheritance patterns describes about the distribution of genetic variants in families. The disease…
Q: I. In the fruit fly Drosophila melanogaster, tan body color (B) is dominant to black (b), and dark…
A: A dihybrid cross is a mating method in which the parents have two separate, genetically determined…
Q: What are the effects of IL-10 on peripheral nerve terminals of nociceptor neurons. stimulatory…
A: The effect of IL 10 on Peripheral nerve terminals of nociceptor neurons is Inhibitory. Nociceptor…
Q: The electrons that enter the mitochondrial electron transport chain come from ______. Electrons…
A: The electron transport chain (ETC) is a standard process in cellular respiration and photosynthesis.…
Q: lateral line, caudal fin, ventral fin, and dorsal fin in a Milkfish?
A: Milkfish - Chanos chanos Belongs to order- Gonorynchiformes and family- Chanidae
Q: Syphilis is a sexually transmitted disease. How are the primary, secondary, and tertiary stages of…
A: Introduction: Syphilis is a sexually transmitted illness (STI) that, if left untreated, can result…
Q: For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…
A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…
Q: give a detailed overview of how tryglycerides are metabolized under aerobic conditions. note the…
A: Triglycerides are made up of 3 fatty acids and glycerol. Life pages enzyme breaks the bond and…
Q: The diseases of a stomach can be accompanied by decrease or increase of the contents of a…
A: The disease of the stomach can be accompanied by a decrease or increase of the contents of…
Q: Assume that long fingers are Inherited as a recessive trait with an 80% penetrance. Two people…
A: The percentage of people with a specific genotype who also displayed the predicted phenotype is…
Q: In a cell membrane, which of the following will be able to freely move from one side of the bilayer…
A:
Q: Just Explain the difference between density-independent and a density-dependent processes…
A: There are various factors or processes which affect the population growth and the population size in…
Q: Should more weight should be given to genetic data or to information derived from comparative…
A: Genome refers to a complete set of genes in an organism. A taxonomic classification is a scientific…
Q: Relate microorganism with food security
A: Introduction: Microorganisms are living things that are so small they can only be seen under a…
Q: Which of these statements are true about predictions and hypotheses? (4 are true) □ If the results…
A: The statements which are true about hypothesis and prediction are : A) if the result of the…
Q: Explain the function of large male canines in a sexually dimorphic primate species: Examine the…
A: Introduction Lemurs, lorises, tarsiers, monkeys, apes, and humans are among the diverse collection…
Q: What is a “meatus”? What does “lateral” mean? What is the difference between the terms…
A: While studying human anatomy( interior structure of the body),There are different anatomical terms…
Q: 1.The man sat motionless for a long time in an awkward position on a hard surface. After he got up,…
A: The nervous system's primary function is to detect and analyze environmental (endogenous and…
![BIOINFORMATICS
Please solve the questions about(Akt 1) can use NCBI
Please help me
1.What is the official genename of the gene? Do you have
another names?
2.Find nucleotide sequence of reference sequence of your gene.
3.Find refseq transcript number of your gene. Make BLAST of
two of refseq transcript. Show the Blast result. (You can take
screenshots)
4.Find refseq protein sequence number of your gene. And
download the amino acid sequence of your gene.
5.What is the chromosome number is it located?
6.What are the coordinates of the gene?
7.How many bp is the length of the transcript? (Hint: not
RefSeq transcript)
8.What is the transcript access number?
9.How many exons and introns does it have?
10. What is the sequence of the first exon?
11.How many nucleotides long is each exon?
12. What is the UniProt accesion number of your genes for
human?](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fd5f92c7a-95bf-4705-9681-024092a8f41a%2Fbb4bb83c-2e38-4ef6-b17c-a2e777e5c03a%2Fhgnumgw_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- u+ 2:24 * © . Fundamental of Bio-informa.. Log out DAMINOV AKHMADILLO on 3 In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are sorted is ed I out of Select one: g O 1. log2(n) on O 2. nlogn 3. n O 4. None of above 个 TOPAvailable whis.picture. https://www.phys.ksu.edu/gene/photos/sd.html.g will help vou imagine the results for plateCA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutation
- NEED ASAP Using the list provided (note you may not need all the steps listed) state the steps in cDNA production 1. Confirm size of bands by comparing to molecular size marker. 2. Ligate oligonucleotides onto blunt ended product. 3. Cut the cDNA with a unique restriction enzyme. 4. Ligate the cDNA and vector followed by transformation of E. coli. 5. Plate cells onto LB-ampicillin plates containing X-gal. 6. Choose colonies that are white in colour. 7. Cut plasmid with unique restriction enzymes. 8. The size of the clone is small and it will ensure that the entire gene will be found in one fragment. 9. Employ replica plating technique and select cells that are ampicillin-sensitive and tetracycline resistant. 10. Blot petri plates with a nitrocellulose filter, lyse the cells and denature the DNA with a dilute sodium hydroxide solution. 11. Blot electrophoresis gel with nitrocellulose filter and denature the DNA with a dilute sodium hydroxide solution. 12. Flood the filters with…Available (C hope this picture, https:://www.phys.ksu.edu/gene/photos/sd.html,e will help you imagine the results for platelQUESTION: Transcribe the gene. Write out the correct sequence of m RNA bases. Notice that this is the same gene as in B above. Recall that in RNA, thymine (T) does not exist and uracil (U) takes its place. 3' ССА TAG CÁC CTT GTC ACA ACG TGT TCG TAG ACA 1 3. 4. 6. 7. 8. 9- 10 11 AGG AAC АТА ATA GTT AAC CTT TTG ATA ACA ТТА ACT 12 13 14 15 16 17 18 19 20 | 21 in
- TOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
- Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…15/doc.aspx?sourcedoc={dac0ebeb-b019-4578-911c-98.. Search (Option + Q) Review View Help Table O Editing er Av A =Expand PCR? Describe the different Steps involved in this technique?SEE MORE QUESTIONS
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)