14. What is the major organic product obtained from the following reaction? CH3 CH3 Br Br &&& Br2 FeBr CH₂₂ CH3 2 Br Br CH's 3 CH CH3 CH3 4 Br
Q: raw the reaction between sphingosine and arachidonic acid. Draw out the full structures.
A: Sphigosine is the platform molecule of sphingolipids. Arachidonic acid is a 20 carbon fatty acid…
Q: Draw the major organic product of the following reaction sequence. .COzH CH3COCI, pyridine
A: Major product will be acid anhydride Explanation:Step 1:carboxylic acid will transformed into acid…
Q: Staphylococcal nuclease has a ΔΔG‡ of -84.1 kJ mol-1 at 25.0 °C. If the uncatalyzed rate is…
A: We know that,ΔG = -RTlnKΔG = change in gibbs energy,when operated at 25 oC = 25 +273 = 298K from…
Q: Which of the following has the compounds shown in the correct order of decreasing acidity (i.e.,…
A: Step 1: • Let's understand step by step: 1) Acidic Behavior: A compound is considered acidic if it…
Q: I need answer expert solutions please
A: Certainly! Let's break it down:1. Composition: The disaccharide consists of two glucose molecules…
Q: Please help me fill in all the information
A: In order to finish your diagram, you would have to: Assign the proper labels to Complexes I, II (if…
Q: Tt O 8. What are the driving forces that promotes tertiary -3D and quaternary -4D structure…
A: Proteins are the biological macromolecules. They show great diversity in their structure and…
Q: Draw the structure of phosphatidylcholine at pH 7 with the moiety on R₁ as 14:0 (C14) and R2 as…
A: Major elements of biological membranes are phospholipids, which include phosphatidylcholine and its…
Q: Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they…
A: Detailed ExplainationCompetitive Metal Chelation:Dicarboxylic acids, such as citric acid, have…
Q: Question 12 In the tertiary structure of a protein, the R-group of valine can interact with the…
A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…
Q: Give 2 similarities and 2 differences between transcription and replication
A: Transcription and replication are vital processes explained in the central dogma of molecular…
Q: In three sentences describe how Sanger sequencing works
A: Copying DNA: To determine the sequence of DNA, scientists start by making many copies of the DNA…
Q: -22 2. (10 pts) Overlapping part of wave function of C-O bond (from to + in x-axis) is expressed by:…
A: The detailed ans has been attached. Explanation:
Q: A genetic variant is associated with low penetrance but high expressivity. This means the variant is…
A: High chance of showing disease symptoms but symptoms will be mild: This option is incorrect Low…
Q: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…
A: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…
Q: A partial diploid in E. coli is created so that LacI is no longer expressed from the genome and is…
A: Partial diploid E.coli has both chromosomal DNA (i.e. genome) and plasmid DNA, but all the genes are…
Q: 1. Substrate Enzyme 1 2 3 Look at the above diagram and understand what is being shown. Explain AND…
A: Enzymes are proteins that catalyze biochemical reactions. The substrate binds to the enzyme's active…
Q: A student performed an enzyme inhibition reaction to experimentally determine the inhibitor constant…
A: The Dixon plot is a graphical method used in enzyme kinetics to determine the inhibition constant of…
Q: 8) Consider the tetrasaccharide stachyose drawn below. Stachyose is found in white jasmine,…
A: Stachyose is a tetrasaccharide consisting of two D-galactose units, one D-glucose unit, and one…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, ẞ-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: Biochemistry (Topics: Glycolysis and Citric Acid Cycle) - If glucose is labeled with 14C in C-2,…
A:
Q: Question 9
A: The question is asking us to identify the enzyme that is responsible for separating DNA strands…
Q: Which is true of the following compound? It probably came from the hydrolysis of an oil The complete…
A: The compound considered has a structure shown below:It is a long chain carboxylic acid with three…
Q: Which of the following statements inaccurately describes glutamate dehydrogenase? Glutamate…
A: Option a: This option is correct because Glutamate dehydrogenase can utilize either NAD+ or NADP+ as…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options…
Q: Consider the tripeptide phenylalanylcysteyl methionine. Part: 0 / 2 Part 1 of 2 Draw the structure…
A: the structure of phenylalanylcysteylmethionine (abbreviated as Phe-Cys-Met) at physiological pH.…
Q: Choose the correct product for the following Diels-Alder reaction. OEt OEt product OEt OEt OEt OEt…
A:
Q: What percentage of max is obtained when the substrate is present at 80% of the Km? Use two digits in…
A: is the maximum velocity attained by an enzyme during a reaction. is the substrate concentration at…
Q: A useful method for studying membrane proteins in place in the membrane is a. nuclear magnetic…
A: Membrane proteins are common proteins that are the part of biological membranes.
Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…
A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…
Q: group)? 9. Probability of finding prolines in ẞ-turns are much more in comparison to a-helices or…
A: The preference for proline residues in β-turns compared to α-helices or β-sheets is primarily due to…
Q: enzymes do pol 6: Would replacing phosphate (PO4) with sulfate (SO4) in glycerophospholipid have any…
A: The question is asking about the potential effects of replacing the phosphate group (PO4) with a…
Q: Formic acid is in the venom of some ant species. What is the pH of a 0.5 M solution of formic acid…
A: For weak acids, we can use the equilibrium constant (Ka) and the initial concentration of the acid…
Q: 2. The diagram to the right shows the change in the structure of the C-terminal portion of each of…
A: Therefore, the final answer is: (a) Without the His146 residue, CPA-treated hemoglobin would have a…
Q: B- Calculate the missing value of the amino acids listed in the table below. Amino acid…
A: Amino acids are the basic units of proteins. They have an amino group, a carboxyl group and a side…
Q: Describe the propagation stage of peroxidation reaction by showing peroxidation of oleic acid.…
A: Lipid peroxidation is a process that breaks down cell membranes and can cause cell damage and lead…
Q: 10. A new protein of unknown structure has been purified. Gel filtration chromatography reveals that…
A: From the given data, we can deduce the following about the protein's tertiary and quaternary…
Q: Answer the following questions concerning sulfathiazole below by filling ieach blank with the…
A: Step 1: In sulfathiazole, the nitrogen atom is indeed sp² hybridized. This means that one of the…
Q: An π helix can be described as a 4.4 helix. Explain 16 what this designation means. Given the pitch…
A: ●A π helix is a type of secondary structure found in proteins.The amino acids in a standard π-helix…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts…
A: The objective of the question is to identify an amino acid that could replace the Serine (Ser)…
Q: 3. In your textbook the termi- nal enzyme catalyzing the ter- minal step of glycolysis is known as…
A: Approach to solving the question: Detailed explanation:This contains information related to the…
Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R, and R,…
A: Salt bridge is a bond between amino acids which carry opposite charges. The opposite charges exert…
Q: Propose structures for intermediates A and B in the scheme below. This three-step conversion is…
A: Citrate is isomerized to isocitrate in the citric acid cycle via dehydration and rehydration. These…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: What are the donor atoms involved in Aspartame-Cu(II) binding? A) Nitrogen atom of alpha amine group…
A: Aspartame contains two amino acid residues, aspartic acid and phenylalanine, linked by a peptide…
Q: 1. a. Draw the following pentapeptide: lysine-leucine-aspartate-threonine-phenylalanine b. Label the…
A: In the drawn pentapeptide, each amino acid is represented by a letter code, and the peptide bond is…
Q: A particular enzyme has a ΔΔG‡ of -22.1 kJ mol-1 at 37.0 °C. Calculate the rate enhancement of this…
A: where:- k is the rate constant,- k_B is the Boltzmann constant,- T is the temperature in Kelvin,- h…
Q: Classify each of the amino acids below. Note for advanced students: none of these amino acids are…
A: Certainly! Amino acids, the building blocks of proteins, are typically classified by the properties…
Q: Under extensive energy needs cells are constantly converting sugar into CO2 as a result of cellular…
A: During cellular respiration, cells convert sugar into carbon dioxide (CO2) and other byproducts.…
Step by step
Solved in 2 steps with 2 images
- What is the major organic product obtained from the following reaction? 3 1 4 2 CH22 Zn(Cu) Et20 H3C H3C 1 2 IH2CWhat is the major organic product obtained from the following reaction? CH3 2 4 3 1 (CH3)2C=CH2 HF CH3 CH3 CH3 1 2 3Select the aldol condensation product of the following reaction. a A b B с C d D e E A H HO H NaOH, EtOH heat H H B D E
- What substitution product are you expecting from the reaction below? NaCl O O O OH CI xo OCH 3 xox This reaction is unlikely to do a substitution reaction. 00 €Question 54 Electron transport and chemiosmosis (is the movement of ions across a semipermeable membrane, down their electrochemical gradient.) occur during both aerobic cell respiration and photosynthesis. What is the purpose of electron transport and chemiosmosis in both cell respiration and photosynthesis? O To create sugar molecules from oxygen gas O To create water molecules from carbon dioxide gas OTo use the energy released from slowing electrons to build ATP OTo usc he energy released from slowing electrons to create lightC Select the product of the following aldol condensation reaction. a A b B C [] d D e E A H H H B H KOH, EtOH heat OH с D E
- 4c give the product if the reaction will occur, write no reaction if noneDraw the major organic product for the following reaction. 1. LiAlH ཝ་རི་-w;"", - CH3-C C-CH 2.1.What are the major products obtained from the following reactions? Indicate the geometry (cis/trans). a) HBr, CH,COOH H3CH2C-CEC-CH2CH3 ? b) H- -C4 H9 ? CH,Cl2 2 2. For each reaction, give the expected substitution product and predict whether the mechanism will be first order (Sy1) or second order (Sy2): a) 2-chloro-2-methylbutane + CH;COOH b) isobutyl bromide + NAQME, c) 1-iodo-1-methylcyclohexane + CH,CH;OH
- Draw the major organic product of the following reaction: 1. (CH3CH2)2NH, H+ (cat.) 2. о H 3. H3O+The decomposition of various substituted benzyl azoxyarenesulfonates in trifluoroethanol was studied. The overall reaction is shown below F3C OH CF3 HO,S + N20 The decomposition of various substituted benzyl azoxyarenesulfonates in trifluoroethanol was studied. The overall reaction is shown below F,C OH HO,S + N,0 Y kobs (S ') 3-CI CH3 3.1 x 10-7 4-CI CH3 2.3 х 10-6 3-CH3 4-CH3 4-OCH3 CH3 CHs 4.7х 10-6 CH3 7.6х 10-6 CH3 6.0 x 10-5 1.7 x 10-3 4-CH OCH3 4.24 x 10-5 4-CH3 4-CH3 4-CH3 CH3 Br 6.0 x 10-5 1.91 x 10-4 CN 4.65 x 10-4 a. Using the data provided, prepare Hammett plots to quantify the effects of the substituents X and Y on the reaction's rate. Attach them to your problem set. b. Based on your Hammett analysis, propose a complete, curved-arrow mechanism for this reaction. Use a sentence or two to explain how your Hammett analyses support your proposed mechanism.What is the major organic product obtained from the following reaction? NaOH, H,O Δ ཨི ཁ (O) 2 ས () 3 1 4 3 2