4. A tetrahybrid smooth, yellow, cut, scattered- hair tomato plant is self-pollinated. Peach or pubescent fruit, white flowers, potato (not cut) leaf margins, hairy stems/leaves are respectively their recessive counterparts. How many phenotypic classes are there in the progeny? What fraction of the offspring can be expected to be peach, white, potato, hairy? What fraction of the offspring can be expected to be peach, yellow, potato with scattered hairs? Solution

Q: A mother with A positive blood is pregnant with her second child. Her first child had A negative…

A: * In this case, the mother's immune system won't fight the foetus. *ABO blood type system is…

Q: Which is the simplest monosaccharide? How is it synthesized in plants

A: Polyhydroxyaldehydes or ketones with an unbranched "C" chain are called monosaccharides.  *The most…

Q: Which factors cause vasodilation? a decrease in O2 an increase in adenosine a decrease in K+ an…

A: Vasodilation means when the lumen of the blood vessels gets widened and this would increase the…

Q: Mentions research 6 titles related to zootechnics.

A: Zootechnics is the art of managing handling, breeding,  and care of animals. It is also called…

Q: D. If a phenotypic female does not have a Barr body, then what does this tell you about her…

A: Introduction  Embryonic development refers to the process by which a fertilized egg develops into a…

Q: Explain the relationship between DNA and natural selection.

A: Introduction :- Natural selection is the process by which organisms that are better adapted to their…

Q: poron. What does each part of the operon aO? Describe the process of DNA replication. (Your answer…

A: Replication is the biological process of producing two identical replicas of DNA from one original…

Q: One of the most surprising findings from randomized controlled trials on vitamin D is that: a.…

A: Vitamin D is a fat-soluble vitamin that plays a crucial role in several important functions in the…

Q: What if anything have you done to improve your cardiovascular system? What behavioral changes do you…

A: Introduction: To obtain oxygen into the blood, the circulatory system (cardiovascular system) pumps…

Q: S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase…

A: Cell signaling is the process by which cells communicate with each other and respond to signals from…

Q: 7. A healthy dose of skepticism is an important component of the nature of science when scientists…

A: Skepticism is a critical attitude of questioning and doubting claims and arguments, particularly…

Q: Exercise 2. Complete the table with producing plant, Family, CHD English/Latin names. Producing…

A: Different plants may have similar physical appearances, and misidentification or substitution can…

Q: if a cell has a net positive charge inside and there is a net negative charge outside the cell,…

A: The plasma membrane or the cell membrane is the external covering of the cell-protecting the cell by…

Q: What parasites other than those observed can be diagnosed by using blood smears.   Give the names…

A: The parasite Identification helps the analysts to see significant reservoir host,as well as…

Q: Provide a diagram of the diffrentinal diagnosis of microsytic anemia.  Provide a diagram of the…

A: Thalassemias, chronic disease-related anaemia, lead poisoning, and X-linked sideroblastic anaemia…

Q: 5. Frederick Griffith observed that an unknown but heritable substance could move from a dead…

A: DNA is the genetic material that is composed of two antiparallel polynucleotide strands. Oswald…

Q: In order to be activated, the [Select] to bind to [Select] [ Select ] [ Select ] [Select] N…

A: Introduction  Cell signaling, also known as signal transduction, is the process by which cells…

Q: Ninhydrin is a compound that is commonly used in forensic identification, because it turns purple in…

A: Ninhydrin is a compound used in forensic identification to detect the presence of amino acids in…

Q: you had a polyC RNA and put it in a reaction with ribosomes and tRNAs (and all of the other…

A: The process of the synthesis  of messenger RNA with the help of the template strand of DNA is called…

Q: The cancer type that is the fourth biggest killer in the US for both men and women Pancreatic Liver…

A: Cancer is a complex disease that is caused by genetic mutations that interfere with normal cell…

Q: Exercise 3. Complete the table with the ways of CHD using and drugs obtained from it. CHD Polygonum…

A: Plant identification is required in the analysis of herbal medicines and natural products because a…

Q: For individual 1, telomeric mode value is 9.49 Kb. This means that this indivdual... a. All…

A: Telomeres are repetitive DNA sequences located at the ends of chromosomes that protect them from…

Q: Lab Exercise: Titration Curve of Alanine. Give and explain the titration curve of alanine. Why is…

A: Answer: The alanine titration curve shows how the pH changes in relation to the volume of titrant…

Q: A woman with type A blood has a child with a man with type AB blood. Show ALL the possible crosses…

A: The presence or absence of antigens on the surface of red blood cells determines blood type. The…

Q: Organism 2 Field Notes: Specimen collected from Hunting Island state park in southern South…

A: Plant kingdom is a kingdom which comprises of photosynthetic , autotrophic plants . Plant kingdom is…

Q: How are transgenic animals made and how can they be used to affect endocrine function?

A: Introduction  Transgenic animals are animals that have had foreign DNA introduced into their genome…

Q: This lab exercise requires that we count certain Mendelian traits among students present in the lab.…

A: Introduction :- The Hardy-Weinberg Equilibrium formula is used to calculate the frequency of alleles…

Q: Please put the following steps of immune activation in order. ✓ The pathogen is eliminated. Multiple…

A: The immune system is described as the defense system of the body that protects the body from the…

Q: Identify the epithelial tissue shown.

A: Introduction - Form continuous sheets (fit like tiles)Apical SurfaceAll epithelial cells have a top…

Q: Immunoelectrophoresis tests: - What are pl and pH? - How to identify the pl and pH?

A: Immunoelectrophoresis is a laboratory technique that combines electrophoresis and immunodiffusion to…

Q: Give written answer with explanation and conclusion With respect to nucleic acids (a) what is…

A: A mutation is a genetic alteration in the DNA sequence of an organism. Errors in DNA replication,…

Q: How did the classification of a microorganism change from kingdoms to domains of life? * How do cell…

A: This question includes the several topics related to the classification and evolution of…

Q: For the cat, whale, and bat, indicate what type of movement each limb is responsible for.

A: Introduction :  Homologous structures : These are the structures which have similar basic structure…

Q: Passive transport * Is when an ion flows down a gradient to enter or exit a cell Does not require…

A: The cell membrane serves as a barrier between the internal and external environments of the cell.…

Q: What are the five functional elements of a reflex arc? Explain each briefly. 2. What is a somatic…

A: The nerve pathway that is followed by a reflex action is called the reflex arc. The reflex arc is…

Q: help.

A: Introduction :- Cancer is a group of diseases characterized by the uncontrolled growth and spread of…

Q: what would happen if wingless were expressed throughout the embryo

A: Embryo: An embryo is the early stage of development of a multicellular organism, starting from the…

Q: A. Which parent has UBE3A deletion? Mother I-1 Father 1-2 B. What is the probability of III-1 to…

A: Introduction :  Genomic imprinting occurs when the sex of the person transferring a gene or…

Q: As the environmental temperature decreases, what happens to a cell membrane? A. It becomes more…

A: The question asks about the effect of a decrease in environmental temperature on a cell membrane.…

Q: The patient phenotypes as group AB, D-positive. Her antibody screen is negative on the sample drawn…

A: Introduction :- Blood is a vital bodily fluid that circulates throughout the body, delivering…

Q: A human female heterozygous for X-linked trait causing red-green color blindness marries a red-green…

A: Red Green Colour Blindness:  Red-green color blindness is a type of color vision deficiency where…

Q: write a  sick note on walking pneumonia. write a note addressed to your child’s teacher about why…

A: Pneumonia is a type of respiratory infection that affects the lungs. It is caused by bacteria,…

Q: Using the AACT method, calculate and compare the relative quantity value for your gene of interest…

A: The AACT method (also known as the 2^-ΔΔCt method) is a commonly used quantitative real-time…

Q: The following are characteristic of testosterone use, EXCEPT a. Muscle Hypertrophy. b. Increased…

A: The main sex hormone and anabolic steroid in guys is testosterone. In mammals, testosterone is…

Q: In your paper, respond to the article, Kenya- The Green Belt Movement, by considering the importance…

A: We must throw attention on Kenya's Green Belt Movement by emphasizing the value of this real-world…

Q: la. How many different proteins are in the protein ladder? 1b. Ladder and antibody samples are…

A: SDS-PAGE It refers to the Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis. It is a…

Q: A key feature of the Dobzhansky-Muller model of the genetics of speciation is Sympatry Epistasis…

A: Speciation is the process by which new biological species arise. A biological species is defined as…

Q: Choose all of the true statements below Hint 5 statements are true OExcited electrons move to higher…

A: The science of cell structure and functioning is known as cell biology, and it is based on the idea…

Q: Question 14 A ten-fold increase in the concentration of sodium ions increases the Tm temperature of…

A: DNA (deoxyribonucleic acid) is the genetic material in most of the cells. It is a double stranded…

Q: transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna

A: Nucleic acids are "proteins essential to the structure and operation of all living cells. Nucleic…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.