7. Superhelical Density Bacteriophage A infects E. coli by integrating its DNA into the bacterial chromosome. The suc- cess of this recombination depends on the topology of the E. coli DNA. When the superhelical density (ơ) of the E. coli DNA is greater than -0.045, the probability of integration is <20%; when o is less than -0.06, the probability is –70%. | Plasmid DNA isolated from an E. coli culture is found to have a length of 13,800 bp and an Lk of 1,222. Calculate o for this DNA and predict the likelihood that bacteriophage A will be able to infect this culture.
Q: 1.0 MS2 T4 E. coli 0.5 104 103 102 10- 10' 102 103 10* 1 Cot (mole x sec/L) b.) This next figure…
A: he cot curve is depicted in the diagram above. It explains the process of dentauration. The double…
Q: 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size…
A: STR stands for Short Tandem Repeat . This analysis is a common molecular biology method. It is used…
Q: 6.Rank order the following 10-base dsDNA sequences by "melting" temperature to single strandedness,…
A: In DNA there are four nucleotides, or bases, in DNA: adenine (A), cytosine (C), guanine (G), and…
Q: 5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: 5. Describe the process of DNA sequence of interest detection, using these terms appropriately,…
A: Introduction: DNA sequencing method is used to determine the exact base sequence in a DNA. Three…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: DNA polymer: 3'- CAG TTA AGG CTC CTA GGT TA - 5' a) first 5 bases at the 3' end of the…
Q: 5. Convert each of the following 3' to 5' DNA sequences to 5' to 3' DNA sequences. a. 3' ATCG 5' b.…
A: DNA contains all the genetic information of an organism in the form of genes. These genes are…
Q: 13- Which of the following substitutions do not produce hidden mutations, that can not be observed…
A: The correct answer is (d)single substitution.
Q: 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic sequence in the…
Q: Which of the following alternative steps cannot be employed in the DNA extraction because it would…
A: You have asked multiple questions. I will answer 1st question, as allowed by guidelines. Asked :…
Q: The first genetic test developed for this disease took advantage of a large family of over 2,000…
A: Huntington’s disease is a neurodegenerative disease. The symptoms of the disease start mildly such…
Q: #1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C.…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule which is the genetic material in…
Q: 4) If 20% of a culture of human cells have a DNA content somewhere between 1&2xs (S-phase= 8 hours)…
A: S phase is synthesis phase during which DNA is replicated when the cell is undergoing mitosis.
Q: When Meselson and Stahl grew Escherichia coli in 15N medium for many generations and then…
A:
Q: 5.If the following two primers 3'AAGS' S'CCG3' were used to facilitate the polymerase chain reaction…
A: Deoxyribonucleic acid (DNA) refers to the polymer that is made of nucleotides. A nucleotide…
Q: 5. Show the separation pattern of the following DNA molecules on an agarose gel electrophoresis. 5…
A: Forms of DNA gives different band pattern.
Q: 1.0 MS2 T4 E. coli 0.5 10-4 10-3 102 10' 1 10 102 10 104 Cot (mole x sec/L) b.) This next figure…
A: DNA (deoxyribonucleic acid) acts as genetic material in most organisms. It is also called a genome.…
Q: 1. Describe the mutation that created the Hbs allele: type of mutation, location of mutation on HbA…
A: HbS allele is a mutated version of HbA allele. This results in Sickle cell anemia in human harboring…
Q: 4. The bars in the following sequence indicate the breakpoints of a deletion.…
A: The given sequence has bars indicating the breakpoint of a deletion means we are going to delete the…
Q: 1. The circular plasmid PRIT453 was cut with Smal, HindlII, and EcoRI, singly and in pairs. The…
A: Restriction enzymes are used to digest the plasmids that cleave the DNA sequences at specific sites.…
Q: 6. Which of the following DNA sample composition is expected to have the highest boiling point? A.…
A: As per Chargaff's rule, number of guanine is equal to number of cytosine and amount of thymine is…
Q: 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during…
A: Disulfide-bonded proteins primarily mature in the oxidative environment of the eukaryotic…
Q: . A haplotype is a specific set of SNPs and other genetic variants observed on a single chromosome…
A: DNA can be defined as the type of nucleic acid which is made from deoxyribose sugar along with four…
Q: 7. Which of the following best characterizes the events that occur at an origin of DNA replication?…
A: Replication is the process of duplication of individual strands of a double stranded DNA. The…
Q: What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b.…
A: DNA molecule is a negatively charged molecule which is made up of nucleotides. Each nucleotide is…
Q: 2. Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in…
A: Literally, replication means the system of duplication. In molecular biology, DNA replication is the…
Q: 4. If the structure of a fully relaxed, closed-circular DNA molecule is changed so that the specific…
A: DNA is double helical structure which negatively super coil around positively charged histone…
Q: 9. Estimate the sizes of the bands, in each of the lanes for the gel attached below. Then, for each…
A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…
Q: What can you conclude about the base composition and base distribution of G-C base pairs in the…
A: DNA has a density which is weight divided by volume of about 1.7 grams per cubic centimeter (1.7 g…
Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…
A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…
Q: 3. Predict the number of DNA fragments and their sizes if Lambda phage DNA were incubated and…
A: Restriction enzymes are one of the important tools of recombinant DNA technology. The name…
Q: 5. The genetic evidence for a triple code (three nucleotides are responsible- for one amino acid)…
A: The proteins are produced from the mRNA by the translation process. This function is performed by…
Q: 10. Analyse the following DNA sequences and identify and explain the anomalies you observe. If there…
A: A nucleotide is the most fundamental component of nucleic acids (RNA and DNA). A sugar molecule…
Q: Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’ A. How…
A: A nucleotide consists of a sugar, a nitrogenous base and a phosphate group. A phosphodiester bond is…
Q: A. What is the relationship between the DNA molecular weight and the distance travelled by DNA…
A: DNA is a genetic material and compose of nucleotide bases, ribose sugar and phosphate. It is used in…
Q: 3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they…
A: A molecule that consists of Nitrogen and possess the chemical property of a base, is known as a…
Q: 8.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled…
A: Primer - A primer, as related to genomics, is a short single-stranded DNA fragment that anneals with…
Q: 1 Corals are animals that live on the sea bed. The photograph shows some species of coral. (a)…
A: Introduction A coral reef is an underwater ecosystems that is characterised by corals that construct…
Q: What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the…
A: Extraction of DNA from a banana involves mashing, filtration, precipitation and extraction.
Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…
A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…
Q: 1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt…
A: A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be…
Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…
A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: 6. Which of the following DNA sample composition is expected to have the highest boiling point? A.…
A: Since you have asked multiple questions we will answer the first question for you. If you want any…
Q: Why is the scale of this map in minutes?
A: The genetic map of a chromosome tells the position of different genes.
Q: 3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 mm of 0.35 and an…
A: Introduction :- DNA ( Deoxy ribonucleic acid ) is made up nucleotide units , which are made up of a…
Q: 1. How does site specific recombination differ from homologous recombination? a. It requires a…
A: How does site specific recombination differ from homologous recombination Answer : a. It requires a…
Q: 6. In 1928, before DNA was recognized as the hereditary material, F Griffith performed a series of…
A: A is Heat killed S-strain which are non virulent as it does not killed the mice and is undetected. B…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
- HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
- Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyP2. Calculate the frictional coefficient of a molecule of DNA of 20 base pairs in water at 20C; assume that the hydrodynamic behavior of the DNA itself can be approximated to be rod-like; the viscosity of the solvent is 0.01 g cm-1 s -1C. Which of the following statements are true about double-stranded DNA? Write TRUE or FALSE 1. A + G =C + T 4. C = G 2. A+T=C+ G 5. A = G 3. A+ C = T+G
- The transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why the method would not take place under the conditions described . 1. Which method of DNA transfer between bacteria would not take place if the donor and recipient were separated by a filter with a pore size of 0.45 um or another physical barrier 2. Which method of transfer would be blocked by the presence of high concentrations of DNAase ( enzymes capable of degrading DNA ) ?COMPLEMENTARY BASE PAIRING 1. A B. C. D. E. F OMPTON 2. A. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus 77174: ATG TGTCA AAGACGGT CCTGTTTTGTA CCGTCAGGATTGA 6 GTTTTCATGCCTCCAAATCTT 10 The DNA of each species has a different base composition. Find the base composition of each species, using what you know about complement Human DNA is approximately 20%C