[AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in the TCA (citric acid) cycle. Provide the structure in the protonation state found in physiological conditions.
Q: Which of these situations would produce a Hill plot with a Hill coefficient less than 1? A purified…
A: A Hill plot is used to establish the cooperativity of ligand binding to a protein.NH (Hill…
Q: The Michaelis-Menten equation models the hyperbolic relationship between [S] and the initial…
A: Those proteins or biological catalysts which help to speed up the chemical reaction are termed…
Q: Genetics Question 24
A: The question is asking for the number of sister chromatids in a unicorn cell at metaphase of…
Q: Calculate and plot the vibrational partition function of CSe2 between 500K and 1000K (with a step of…
A: Final AnswerNow, let's plot the total partition function against temperature.Explanation:Step 1…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: 3. The IC50 value for a drug called razundib for a Src kinase is 15 nM. The Src kinase is known to…
A: Src kinase is a tyrosine kinase that catalyses the phosphate group transfer from ATP to the tyrosine…
Q: 11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two…
A: In an alpha helix, each amino acid residue forms hydrogen bonds with the amino acid located three…
Q: A bacterial cell divides in the presence 32p, which is a radioactive isotope of phosphorous. This…
A: In conservative DNA replication both the strands of DNA of the parent cell become part of one of the…
Q: To track cell growth and utilization of the limiting substrate in a bioreactor, the yield is…
A: S=Y(X0−S0)X−X0+S0Explanation:Lag Phase: The growth rate is zero (μ = 0) since there is no…
Q: A useful method for studying membrane proteins in place in the membrane is a. nuclear magnetic…
A: Membrane proteins are common proteins that are the part of biological membranes.
Q: For competitive inhibition: a. the value of Km decreases b. the value of Vmax decreases c. it is…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: If the Gibbs free energy change for the reaction; Succinate + FAD Fumarate + FADH2 is -40KJ/mol at…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: If the membrane potential of a neuron drops to -55mV and sodium ions start to flow from outside to…
A: Concentration of ion gradients across a membrane and selective movements of ions along gradient…
Q: GQ5
A: The question is asking about the stage of cell division in which sister chromatids separate. Sister…
Q: Using the information given, determine the Kd for the binding of HABA to BSA. B= y-intercept (E…
A: Y=mx+b is the equation of a line that is not passing through the origin. In this equation, m is the…
Q: Using BME will disrupt which structures of a protein consisting of a single chain? Secondary,…
A: A protein is a large biological molecule made up of amino acid residues linked together by peptide…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Н HCG 6 N 5 7…
A: Deoxyribonucleic acid (DNA) is a molecule that is present in all known living things as well as many…
Q: What did experiments using porcelain filters prove? Select all answers that apply. Porcelain filters…
A: Porcelain filters were engineered in the late 19th century by scientists as bacteriological filters…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: The production of ATP in liver cells when the malate-aspartate shuttle isn't working properly. The…
Q: Consider the following structure. CO₂CH2CH3 CO₂CH2CH3 This substance could be produced by the…
A: True.As it was a Diels-Alder Reaction so the given structure will be produced.Explanation:It is a…
Q: The Drug AZT is used to treat AIDS, This drug is a _____ Inhibitor/Activator of _____ a)…
A: HIV stands for human immunodeficiency virus. HIV destroys a type of white blood cells that help the…
Q: Glycogen contains___ linkages that ___ be digested by animals. a α1 --> 4 glycosidic ; can b α1-->…
A: Glycogen is the storage sugar in animals. It is composed of units. There are two types of…
Q: N - Leucine - Arginine - Proline - Aspartic acid - Methionine - C write the structure classify the…
A: Peptides are composed of amino acids that are bonded to each other via peptide bonds. The ionizable…
Q: Using the image provided, answer the two questions:- Based on their fat content, which is the…
A: The objective of the question is to determine the healthier option between Margarine A and Margarine…
Q: GQ3
A: The objective of the question is to understand the sequence of events that occur during meiosis and…
Q: 23. Calculate the free energy of hydrolysis ATP in a rat liver cell in which the ATP, ADP, and Pi…
A: The objective of this question is to calculate the free energy of hydrolysis of ATP in a rat liver…
Q: Consider a gene being transcribed at a constant rate k1 and being degraded with first order…
A: The genetic information from protein synthesis is stored in DNA. This information is copied onto an…
Q: 3) In his haste to create the chapter 2 homework assignment, the biochemistry professor quickly drew…
A: Amino acids are the building blocks of proteins. They have two functional groups . Amino group and…
Q: What is the molecular weight of the molecule that gets eluted from the column at 10 ml?
A: The given graph shows a linear relationship between the elution volume (ml) on x axis and IgM…
Q: Identify 2 independent helices domains Identify a disordered region In the structure, box the…
A: Proteins are essential molecules that perform many important functions in cells. They are made up of…
Q: 6. Discuss the potential contributions of ionic interaction, hydrogen bonds, hydrophobic…
A: Aspartic acid (Asp) contributes to ionic and hydrogen bonds, while hydrophobic and Van der Waals…
Q: Question 1: tRNA and amino acyl tRNA synthetases Part a: How many codons encode the amino acid…
A: Methionine is encoded by a single codon, AUG, which also serves as the start codon in protein…
Q: Enzymes are biological catalysts that decrease the activation energy necessary for a chemical…
A: Oxidoreductases are a class of enzymes that catalyze redox reactions. Oxidoreductases generally uses…
Q: Ala-Cys-Glu - Tyr - Trp - Lys - Arg - His - Pro-Gly NAZO Glu pka 4.15 SH Tyr RO 10.10 Draw Charges…
A: Proteins are essential biomolecules composed of amino acids arranged in four structural levels:…
Q: Gleevec inhibits an enzyme needed in cancer cell proliferation. It acts by increasing the enzyme's…
A: Gleevec, also known by its trade name imatinib and internationally as Glivec, is an oral medicine…
Q: 1) Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: Refer to figure 1D of the Science Article. Which produces the greatest inhibition of PDE…
A: In the experiment described, the researchers tested the inhibitory effects of different…
Q: Proteins from which compartment of the bacterial cell are likely to be found in the supernatant…
A: The objective of the question is to identify which compartments of a bacterial cell are likely to…
Q: What is the target for the following compound? O Muscarinic receptor O Acetylcholinesterase enzyme O…
A: Acetylcholine is a neurotransmitter. Many enzymes and proteins involved in the metabolism and…
Q: What is the driving force that promotes secondary structure formation of alpha helices and beta…
A: Alpha-helix and beta-sheets are the two most prominent regular secondary structures in protein.…
Q: The conversion of pyruvate into acetyl CoA consists of three steps. Identify these three steps and…
A: The pyruvate dehydrogenase complex (PDHC) is an enzyme complex composed of 3 enzymes.Pyruvate…
Q: Provide a stepwise, arrow-pushing mechanism for the following transformation. You may use general…
A: The reaction in question involves a lysis reaction catalyzed by a lyase enzyme using the coenzyme…
Q: 7. Why proteins prefer to have a-helices or ẞ-sheets in their interior core, instead of random coil…
A: The preference for alpha helices and beta sheets in the interior core of proteins is driven by a…
Q: Q5. A sh mutant called shXS is isolated that produces a truncated polypeptide of only 6 AAs in…
A: The objective of the first question is to identify a single basepair DNA change that would lead to a…
Q: How many TCA cycles required to fully oxidize 1 molecule Acetyl-CoA. Support your answer with…
A: There are two oxidizable carbons in acetyl-CoA; the methyl carbon (CH3-) and the carbonyl carbon…
Q: What is the target for the following compound? O Muscarinic receptor O Acetylcholinesterase enzyme O…
A: Acetylcholine is a neurotransmitter. Many enzymes and proteins involved in the metabolism and…
Q: 3A.Describe the difference in biological func on of myoglobin and hemoglobin in the body. How does…
A: Myoglobin and hemoglobin are both proteins involved in oxygen transport within the body, but they…
Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…
A: The objective of the question is to identify the coding and template strands in the given DNA…
Q: Which irreversible inhibitor is also known as a substrate analog? affinity label transition-state…
A: Irreversible inhibitors play a crucial role in biochemical research and drug development by…
Q: 2. Match the following molecules with the-corresponding test reagents that are used to identify…
A: Biochemical tests are very important in the field of biology and biochemistry. These tests are used…
Step by step
Solved in 3 steps with 5 images
- Because of the position of arsenic in the periodic table, arsenate (AsO43- ) is chemically similar to inorganic phosphate and is used by phosphaterequiring enzymes as an alternative substrate. Organic arsenates are quite unstable, however, and spontaneously hydrolyze. Arsenate is known to inhibit ATP production in glycolysis. Identify the target enzyme, and explain the mechanism of inhibition., which indicates AG for each glycolytic reac- tion under intracellular conditions. Assume that glyceraldehyde-3- phosphate dehydrogenase was inhibited with iodoacetic acid. Which glycolytic intermediate would you expect to accumulate most rapidly, and why?[AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in the TCA (citric acid) cycle. Provide the structure in the protonation state found in physiological conditions. 9 H-C-OH 800- -H CH₂ ° Coo of NAD+ dehydrogen isocitrate ase NADH, H*, Drawing CO2
- #1 Specify the role each of the following amino acids play within the crystal structure and/or active site for Be as specific as possible, with pictures (and mechanistic arrows) as necessary. His11 Arg140 Glu89 Trp68 #2 Provide a step-wise mechanism for the reaction Bisphosphoglycerate mutase catalyzes, using the amino acids responsible for aiding in catalysis. You do not need to add surrounding amino acids that aid in substrate specificity. (drawn out)If a 0.1 M solution of glucose 1- phosphate at 25 °C is incubated with a catalytic amount of phosphoglucomutase, the glucose 1-phosphate is transformed to glucose 6-phosphate. At equilibrium, the concentrations of the reaction components are Calculate Keq and ΔG′° for this reaction.(b) the activity of the malate-aspartate shuttle (MAS) system of isolated rat brain mitochondria suspended in an isotonic me- dium buffered to pH 7.4. Diagram A illustrates NADH fluo- rescence emission upon addition of Glutamate in the ab- sence and presence of Aspartate. Diagram B illustrates sim- ilarly NADH fluorescence emission upon addition of Gluta- mate in the presence of Aspartate followed by additions of submicromolar concentrations of Ca2+. As is well estab- lished, the MAS in brain, skeletal muscle, and cardiac mus- Diagrams A and B on the right show changes in Glu A Glu В -No Asp + 0 +0.12 -0.48 + 16 0.81 +1.8 ++ Asp 10 min 2 min cle mitochondria is activated by cytosolic concentrations of Ca2* < 3 µM. To simulate the cytosolic part of the MAS, the following reagents were added to the medium: 4 units/ml glutamate-oxaloacetate transaminase, 6 units/ml malate dehydrogenase, 66 µM NADH, 5 mM aspartate, 5 mM malate, 0.5 mM ADP, 200 nM ruthenium red (to block the mitochondrial…
- Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate the K'eq of the reaction Pyruvate + NADH <=> Lactate + NADH+H+.Note the temperature of this reaction will not affect the standard reducton potential delta E'o in the table 13-7b.The interconversion of DHAP and GAP greatly favors the formation of DHAP at equilibrium. Yet the conversion of DHAP by triose phosphate isomerase proceeds readily. WhyCertain microorganisms with a modified citric acid cycle decarboxylate a-ketoglutarate to produce succinate semialdehyde: (a) Succinate semialdehyde is then converted to succinate, which is furthermetabolized by standard citric acid cycle enzymes. What kind of reactionis required to convert succinate semialdehyde to succinate? Showany coenzymes that might be involved.(b) Based on your answer in part a, how does this pathway compare to thestandard citric acid cycle in energy yield?
- Begining with 1 M concentrations of each reactant and product at pH=7 and 25.0 degrees C, calculate the K'eq (to one decimal point) of the reaction Pyruvate + NADH+H+ <=> Lactate + NAD+.Note the temperature of this reaction will not affect the standard reducton potential delta E'o in the table 13-7b. please provide a comprehensive explanation with each step taken.The protein catalase catalyzes the reaction 2H,O,(aq) — 2H,O(l) + O,(g) and has a Michaelis-Menten constant of KM = 25 mM and a turnover number of 4.0 × 107 s¯¹. The total enzyme concentration is 0.010 µM and the initial substrate concentration is 4.83 µM. Catalase has a single active site. Calculate the value of Rmax (often written as Vmax) for this enzyme. Rmax Calculate the initial rate, R (often written as V), of this reaction. R = ×10 mM.s-1 mM-s-1In addition to consumption by glycolysis, glucose 6-phosphate is used to generate other 5. (a) key cellular metabolites – including precursors for nucleic acids and modulators of cellular red/ox bal- ance – via the oxidative phase of the pentose phosphate pathway. What nucleic acid precursor mole- cule and what key cofactor are generated by the oxidative phase of the pentose phosphate pathway? Draw the reactions including all reactants and products that comprise this phase of the pathway.