Q: How does the life cycle of a typical Red alga (Phylum Rhodophyta) differ from any other life histori...
A: INTRODUCTION The Red algae are mainly present in the phycoerythrin pigment. This pigment mainly a...
Q: 5 7. Cross a parent with IAIA Blood type with a parent IBIB Blood type. What are the phenotypes and ...
A: Blood is the fluid that circulate through our body. There are mainly four types of the blood group f...
Q: 2. In tomatoes, 2 pairs of genes affect the phenotypes of ripe fruit with the following alleles. R= ...
A: Answer - A) Rroo x rrOo Rr rr oo Rroo rroo Oo RrOo rrOo The phenotypic ratio of the giv...
Q: Identify the following polysaccharides for each of the following uses: a.) Plants i.) Cell wall ii.)...
A: Polysaccharides are made up of more than 10 monosaccharide units that are joint together by glycosid...
Q: list down 3 Ways on how you can contribute in decreasing or lessening the effects of Climate Change....
A:
Q: All the human races like Africans, Asians, European and others might have from common ancestors. Pro...
A:
Q: Discuss the pathophysiology of Chronic Kidney Disease (CKD).
A: A disease is a distinctly abnormal condition that negatively affects the structure or capacity of al...
Q: Compare similarities and differences between adaptations and non- adaptations by writing yes or no i...
A: We are allowed to do one question or upto three subpart of a question. Please repost the undone que...
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is...
A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the...
Q: Fluid portion of the mitochondrion and also the site of Kreb's cycle. * a, matrix b. stroma С, сytos...
A: INTRODUCTION Answer of question 1-3 is given below.
Q: 4. What would be the phenotypes, phenotypic ratio, and gen kids, if the mother is heterozygous freck...
A: An Individuals receive two variant of each gene from their parent. These variant form of a gene are...
Q: a-helical
A: The alpha helix is the secondary structure of proteins and is a right hand-helix conformation in whi...
Q: Gram-negative bacteria would sain their cell wall. after Gram stain and have in Purple; peptidoglyca...
A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: oxygen as the final electron acceptor? Question 14 1 pts Which TWO of these are correct statements a...
A: Introduction DNA stands for Deoxyribonucleic acid, is a molecule which is made up of two polynucleot...
Q: Which mammals drink the milk of another species for the majority of their lives on a daily/weekly ba...
A: Milk is produced in mammary glands found in the mammals. It is produced by many mammals including hu...
Q: In pea plants, having yellow peas (Y) is dominant over having green peas (y). If you had a yellow pe...
A: That possible genotype is.. A. YY.. homozygous dominant show yellow colour.
Q: Imagine Cas9 used a 30 base RNA molecule instead of a 20 base molecule. How often will it cut? Hint:...
A: Compared to previous techniques for modifying DNA or RNA, this new approach is much faster and easie...
Q: Suppose that there is a 50% of a male child being born. A couple wishes to have exactly two female c...
A: My general response is that it's a 50/50 chance that a woman will have a boy or a girl. But that's n...
Q: Explain what is c-myc translocation and why it results in overexpression of c-myc. What is the role ...
A: c-MYC translocation: c-MYC is the prototype for oncogene activation by chromosomal translocation. I...
Q: Briefly explain why the Mendelian inheritance does not apply to the inheritance of alleles in indivi...
A: Introduction Tay-Sachs disease is a rare genetic condition that causes neurological issues in the br...
Q: Without estrogen, females are at risk for weak bones later in life 2. Progesterone is less importan...
A: Without estrogen, females are at risk for weak bones later in lifeExplaination- It is fact. In fema...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Q: 1.You want to construct a phylogeny of the classes found within Phylum Arthropoda, classes which sha...
A: Non coding region.
Q: Does resulting daughter cells in mitosis and meiosis will have identical features with their parent ...
A: Answer 1- Meiosis is the process through which daughter cells are formed in sexually reproducing org...
Q: According to the article which was written before the COVID-19 vaccine was created, when do people t...
A:
Q: Which of the following is the most common type of chromosomal disorder? O a. Kleinfelter's Syndrome ...
A: Any syndrome produced by an aberrant chromosome number or constitution, marked by deformities or fai...
Q: An animal cell of 60 μm length is enlarged photographically. An enlargement print is made showing th...
A: Introduction Magnification is the method of enlarging something's apparent size rather than its true...
Q: Giving details diagram the process of tetrasporic megagametogenesis. Give full details
A: INTRODUCTION It is a process of maturing female gametophyte in plant production. In the female ...
Q: Which of these could not be considered to be "an organ"? A. neurons B. skin C. eye ball D. blood ves...
A: All living bodies-plants, animals or microscopic organisms, are made up of cells. The term 'cell' is...
Q: Which statement about integument tissues is NOT TRUE? Group of answer choices A. Turtle skin is actu...
A: A- Is not true:- Rather the shell is part of the turtle's body and is made of bones, collagen, skin,...
Q: A cell engulfing a relatively large particle will likely utilize a.exocytosis b.receptor-mediated ...
A: Introduction "A cell is the tiniest, most fundamental unit of life, responsible for all of life's op...
Q: Why are men more prone to hemophilia than women? Elaborate.
A: Hemophilia is a disorder related to blood that causes blood to clot improperly. A deficiency of coag...
Q: available. Research an enzyme that is needed in the human body. Address the following topics: 1. Des...
A: Enzymes are very much essential for our body functions. So understanding their structure, function, ...
Q: Virology: What is a benefit of classifying viruses?
A: Introduction :- A virus is a small collection of genetic code, either DNA or RNA, surrounded by a pr...
Q: Describe the Theory of Endosymbiosis.
A: a)Endosymbiotic theory states that some of the organelles in eukaryotic cell are derived from free l...
Q: Please answer fast Using the image above: A. How many different gametic genotypes can each horse f...
A: Gamete A haploid male or female germ cell that unite with opposite sex to form zygote.
Q: Which lobe of the cerebral cortex is the center for impulse control (the brain's "stop sign")? parie...
A: As the nervous system is one of the most important system present in the body;which are able to main...
Q: The plant Haplopappus gracilis has a 2n of 4. A diploid cellculture was established and, at premitot...
A: Introduction A normal cell can divide by two processes one is Mitotic cell division while the secon...
Q: Draw a diagram of a nucleotide with a deoxyribose sugar. Number the carbons on the sugar
A: Deoxyribose sugar is a 5 carbon ringed sugar which is the sugar that is found in the DNA. It is said...
Q: parents' genotypes: GG parents' genotypes: Gg Gg Gg G. 6. GG GG Gg Gg 6. g
A: Homozygous means that you inherit the very same copy of a gene from both parents, resulting in two i...
Q: Part 2: Data Tables Table 1: Parent Genotypes: Monohybrid Crosses Generation Genotype of Individua...
A: A monohybrid cross is a cross between two genuine breeding parents that differ in only one feature. ...
Q: virion. Describe how the Baltimore classification system classifies viruses.
A: An infectious agent that can only replicate within a host organism is commonly refers as the virus. ...
Q: Why study zoology? The future of man can depend on it! لماذا يدرس علم الحيوان؟ مستقبل الإنسان يمكن أ...
A: Introduction :- Zoology is a part of biology that focuses on the anatomy and physiology, embryology,...
Q: Given that selection cannot favor traits that lower fitness, what might cause a population to move d...
A: The Adaptive Landscape was introduced to the public for the first time in the 1932 publication. Wrig...
Q: help please !!!! thank you in advance
A: Corona virus (SARS COV 2) is a Positive strand, RNA virus that has caused highly deadly changes in t...
Q: PERFORMANCE TASK: Answer the questions in the spaces provided. Limit.your answer to 3-5 sentences. 1...
A: Introduction :- Pangaea was a supercontinent that engulfed almost all of Earth's landmasses in early...
Q: What is the downside of using genetic engineering?
A: Genetic engineering is the process of adding or modifying DNA in an organism to bring about transfor...
Q: Communities of organisms, together with abiotic entities, make up an ecosystem. What are these "abio...
A: Given: Communitiies of organisms together with abiotic entities make up an ecosystem.Ecology is the...
Q: What is the expansion of acronym MICA?
A: Immune system includes cells and molecules involved in protecting body against antigens.
Q: What is characteristic of a pair of homologous (maternal and paternal) chromosomes? O a. G banding i...
A: Introduction:- Homologous chromosomes, also known as homologs, are made up of two chromosomes, one m...
Question-
10 examples of how
Step by step
Solved in 2 steps
- Question 73 Match the description to the specific type of symbiosis. "win-win" symbiosis, both partners benefit [Choose] [Choose ] "win-lose" symbiosis, one partner benefits, the other is harmed utopianism mutualism "win-neutral" symbiosis, one partner commercialism benefits, other neither benefits nor is harmed commensalism parasitismParasite QUESTION 10 This graphs shows the regular cycling resulting from the interaction between of hosts and parasites. Host At equilibrium, what will happen to either the parasite or the host biomass if the density of either the parasite or the host stays the same? O We need more information to answer this question O It will decline O It will stay the same O It will increaseNeed to know the answer in 1 and 2 1.) In the past, sometimes Aboriginal Albertans would purposely set prairie fires in the spring in a type of “controlled burn” in order to begin a secondary succession. Explain why this was done, and why this practice is no longer done. 2.) One of the first species to colonize burned forest is fireweed, a plant that makes a tall stalk of fushia-coloured flowers. Conduct an Internet search to find at least two traditional uses of this plant by Aboriginal peoples.
- PLEASE HELP! Question: Brown marmorated stink bugs are native to China and Japan. They were identified in Pennsylvania for the first time in 1998 and have since spread across North America, feeding on agricultural crops. Which of the following characteristics of the brown marmorated stink bug has led to them being an invasive species in North America? A. They reach maturity slowly. B. They are tolerant of a wide range of environmental conditions. C. They are often eaten by native wasps and birds. D. They have only a few surviving offspring each year.Which term describes the process whereby toxic substances increase along trophic levels of an ecosystem? biomassification biomagnification bioentropy heterotrophyQuestion: The figure below shows the relative abundance (y axis) of shrubs in an ecosystem in the years following a fire (x axis). The shrubs in this ecosystem fall into two functional groups: fire recruiters and fire persisters. If fire frequency increased significantly in this ecosystem, which group would be benefited? Choose one of the option below A- Both functional groups would benefit equally B- Fire persister species C- Fire recruiter species
- 11:08 The graph below shows the species richness of a community undergoing secondary succession. The letters R, S, T, and U identify four distinct seres. Answer the questions by identifying the correct sere. Seres can be used as an answer once, more than once, or not at all. Number of Species Time Which sere is dominated by r-selected species? R Which sere shows the EFFECT of strong competition? T Which sere is the climax stage? XArticle readings: Why some animals are more important to ecosystem than others. From the article, list down all the species being described as keystone species and their negative effect when removed from their ecosystem. Define the ‘Keystone species concept” and differentiate it from “morphological species concept”. How does a keystone species plays its role in having a trophic cascade scenario? 1 sentence only.7) The term "preemptive competition" refers to _________________. Question 7 options: when individuals of one species inhibit individuals of another by consuming a shared resource situations where the occupancy by one individual precludes the establishment of others when one organism grows over another, thereby inhibiting access to some essential resource when chemical growth inhibitors inhibit germination and establishment of other species when nonterritorial meetings between individuals negatively affect one or both of the participant species
- Question:- 1. Discuss how the transcending functions are associated with the integrative levels of organization in Ecology.Question 10. A competitive network results in a more balanced system of dominance compared to a competitive hierarchy. A. True B. False Question 8 Late successional trees have few effective layers of leaves. A) True B) False Question 7 Pioneer species _______________. A) are altruistic. B) are excellent competitors. C) are resistant to disturbance. D) can tolerate harsh abiotic conditions.Question one options: Community development, symbiosis development, population ecology, ecological succession Question 2 options: tolerant, pioneer, primary, secondary, Explain why you believe the answers are correct