Capping of eukaryotic mRNA occurs at the 5' end O occurs at the 3' end O occurs at both ends O doesn't occur at all
Q: The diffusion rate of four different membrane proteins (A, B, C, and D) was measured using a FRAP…
A: FRAP is short for Fluorescence recovery after photobleaching, is a method used for determining the…
Q: Considering that 21.8 kJ/mole of energy is required to transport 1 H+ across the mitochondrial…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: What is the biochemical mechanism by which ingesting 2,4-dinitrophenol (DNP) results in rapid weight…
A: 2,4 DNP is an uncoupler of electron transport chain that is used primarily for weight loss. 2,4 DNP…
Q: Hypo and hyperglycemia, causes and consequences
A: The major sugar present in the blood is known as blood sugar or glucose. It originates from the food…
Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…
A: During DNA replication, each polynucleotide strand serves as a template for the production of a…
Q: Glucose 6-phosphate is fed to a cell line capable of utilizing the pentose phosphate pathway and…
A: There is constant interplay between the Pentose Phosphate Pathway (PPP) and Gluconeogenesis. The…
Q: Wobble hypothesis indicates that: a. fatty acids are degraded 2 carbons at a time. O b.…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Identify the steps in the glycolytic and citric acid cycle pathways where ATP, GTP, NADH, and FADH2…
A: Introduction Citric acid cycle is also known as tricarboxylic acid (TCA) cycle. It is an important…
Q: 1 what is the net reaction of glycolysis? 2 Starting with glucose ( in the open - chain fischer…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises one…
Q: True or False: Passive-mediated transport proteins lower the delta G of transport to create the…
A: Introduction :- The question is all about transport of molecules by diffusion I. e. Active and…
Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…
A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…
Q: Are fatty acid propyl esters (biodiesel) formed in the acid-catalysed…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Which of the following statements is true about the well-fed state? O a. Liver glycogen is…
A: The well-fed state is the absorptive state that begins immediately after meal consumption. It is…
Q: all of the following statements about mitochondrial oxidative phosphorylation are true EXCEPT a. The…
A: The metabolic pathway in which cells use enzymes to oxidize nutrients, releasing chemical energy and…
Q: What is the molecular basis for the difference in the electrophorentic pattern between normal…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Que Tuesday, December well Faudos *The amino acid alanine can be used as an energy source. alanine…
A: Alanine is a glucogenic amino acid, which synthesizes the precursor for glucose synthesis during its…
Q: Identify the structures a-d. (a) (b) (c) (d)
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: Complete the following reaction: P680 + light →_______→ O P680*; P680 + H+ O P680*; P680* + e O…
A: The P680 reaction center is a part of photosystem II. Upon getting hit by photons, P680 gets…
Q: The major site(s) of glycogen storage is/are: A) adipose tissue. OB) liver. OC) skeletal muscle. D)…
A: Glycogen is a Polysaccharide made up of glucose residues. It is a branched Polysaccharide and acts…
Q: By the reaction catalyzed by the pyruvate dehydrogenase complex: a) NAD+ is oxidized to become NADH…
A: The glycolytic process results in pyruvate, which is a substantial source of acetyl-CoA for the TCA…
Q: In term of the sugar identity , what is the difference between DNA and RNA. 2 What nucleobases are…
A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are two of the most important molecules in…
Q: All of the following classes of enzymes catalyze the Fatty acid synthesis except a. synthetase b.…
A: Triglycerides are storage lipids. These are fatty acid esters of glycerol. Excess of Acetyl CoA…
Q: LO 53- Determine the type of mutations based on the effect in the amino acid chain "missense,…
A: Missense, non-sense and silent mutation are the types of point mutation. In point mutation, one base…
Q: Which one of the statements below best describes the mechanism of proton translocation by the…
A: The Q cycle (named after quinol) is a set of reactions. The Q cycle describes how the sequential…
Q: Reaction of alkaline, acid and enzymatic hydrolysis of triacylglycerols.
A: Triacyl glycerols are triglycerides which are formed from 3 molecules of fatty acids and one…
Q: What is acrolein test? explain in 5 sentences essay
A: Triglycerides or triacylglycerides or simple fats are fatty acid esters of glycerols. In…
Q: Complex 2 oxidizes ___ and reduces __ a. FAD, COQ b. COQ , Cytochrome C C NADH, COQ d.…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…
Q: 31) There are several modes for enzyme regulation. What's the difference between competitive and…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Metabolism processes that generate fadh2 are select all that apply beta oxidation…
A: FAD is a derivative of the vitamin B2 or Riboflavin. It acts as coenzyme in most of the oxidation…
Q: Scheme of galactose catabolism. Enzymopathies
A: Galactose (Gal), also known as "milk sugar," is a monosaccharide sugar that is about as sweet as…
Q: Describe method by which uncoupling agents (like 2,4-dinitrophenol) inhibit oxidative…
A: The oxidation of carbohydrates such as glucose generates electrons that are carried to the electron…
Q: During the metabolism of glucose in anaerobic cells, the enzyme lactate dehydrogenase is essential…
A: Lactate dehydrogenase catalyzes the interconversion of pyruvate and lactate. The enzyme is an…
Q: Structure and biological role of phosphatidic acid.
A: The smallest and most basic phospholipid, phosphatidic acid (PA), serves as a precursor for other,…
Q: Positive and negative controls must be included in any immunoassay. Controls are always run before…
A: A variable is any quantity we can measure. In any experiment there are three variables:…
Q: Fatty acids released by hormone sensitive lipase in adipocytes are transported to muscle by: OA)…
A: The adipose tissue stores surplus nutrients in the form of neutral lipids in the body that in turn…
Q: Consider the image of protein synthesis (translation). Identify the two different RNA molecules…
A: Translation refers to the process of protein synthesis. It falls under the process of gene…
Q: Can human digest this trisaccharide?What bond is it between sugar B and sugar C?(be specific)
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 1.0 ml of serum albumin (BSA) solution was precisely diluted to 100 ml with a buffer solution, and…
A: The proteins molecules are constituted of twenty naturally occurring amino acids. The aromatic amino…
Q: IV. Write on the first column the monosaccharide unit(s) that is present in the given disaccharide.…
A: Carbohydrates are polyhydroxy aldehyde or ketone or produce similar units on hydrolysis. The basic…
Q: After several days of fasting, the liver begins producing relatively large amounts of ketone bodies.…
A: Ketone bodies refers to the following compounds: acetone, acetoacetate & β-hydroxybutyrate. They…
Q: true or false: A high dTTP concentration shifts the specificity of ribonucleotide reductase…
A: Ribonuclotide reductase is the enzyme that catalyses the conversion of NTPs to dNTPs. Ribonuclotide…
Q: Which aromatic derivative is the base name of the five membered ring of D-xylose named after? Ofuran…
A:
Q: Urea is an ideal way to remove ammonia from the body because: OA) it does not affect the pH of…
A: Metabolism generates free ammonia.ammonia is toxic to cells so it must be eliminated from the cells…
Q: 1) Gluconeogenesis refers to ________. A) the breakdown of glycogen B) the formation of glucose from…
A: Generally, glucose is the preferred source of energy in our body. But of we are not eating properly…
Q: what is main difference for B-DNA,A-DNA and Z-DNA
A: The two fundamental types of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: Describe how the activity and specificity of ribonucleotide reductase (RNR) is regulated.
A: Ribonucleotide reductase (RNR) catalyzes the rate-limiting step in the only known de novo pathway…
Q: 17.56 The following sequence is a portion of the DNA template strand: TGT GGG GTT ATT a. Write the…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: The lac operon contains three genes: lacZ, lacY, and lacA for ß-galactosidase, galactoside permease,…
A: Lac operon is a model of gene regulation system in prokaryotes. it consists of three genes , lac Z,…
Q: Calculate AG for ATP hydrolysis in muscle at 16 °C. Use the muscle concentrations from the first…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: Tell why the citric acid cycle is obligately aerobic.
A: Glycolysis convert one 6-carbon molecule of glucose-6-phosphate into two molecules of 3-carbon…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainThe following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?exon 1 еxon 2 exon 3 exon 4 5' 3' 13' DNA 15' TRANSCRIPTION exon 1 exon 2 exon 3 exon 4 13' pre-MRNA ALTERNATIVE SPLICING 1 2 3 4 1 4 A В two alternative MRNAS Without knowing the DNA (or RNA) sequence, describe an experiment that would show you the difference between the two alternative MRNAS (labeled A and B) shown for this hypothetical gene. Specifically, how would you know A) How many exons each alternative mRNA contains? You can just describe the result B) Which exons they were? You can just describe the result. min in
- In eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.Post-transcriptional Modification of Eukaryotic mRNAs What might be the advantages of capping, methylation, and polyadenylylation of eukaryotic mRNAs?Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
- A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in YFG transcription. Diagram what this mutant interaction mightlook likeVery few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
- Describe the significance of a 5 cap poly A tail on the mature mRNAThe diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letter