Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that aredifferences between eukaryotes and prokaryotes in this regard.O capping the mRNA on its 5' endO addition of a 3' poly-A tail on the mRNAOsplicing out intronsOrecognition of the mRNA by the small ribosomal subunit

Name: Eukaryotes have very different mRNA processing than prokaryotes do. P
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that aredifferences between eukaryotes and prokaryotes in this regard.O capping the mRNA on its 5' endO addition of a 3' poly-A tail on the mRNAOsplicing out intron

Gene expression involves two processes that is- transcription and translation. Transcription is a…

Science

Biology

Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that are differences between eukaryotes and prokaryotes in this regard. capping the mRNA on its 5' end addition of a 3' poly-A tail on the mRNA splicing out introns recognition of the mRNA by the small ribosomal subunit

Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that are differences between eukaryotes and prokaryotes in this regard. capping the mRNA on its 5' end addition of a 3' poly-A tail on the mRNA splicing out introns recognition of the mRNA by the small ribosomal subunit

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
Which of the following processing events occur during or after the synthesls of MRNA molecules in eukaryotes? Intron splicing Addition of a 5'cap O Cleavage of multiple functional molecules from a larger precursor O Polyadenylation of the 3' end
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Which of the following is unique to eukaryotic mRNA synthesis? O Coupled transcription-translation O Polycistronic mRNA Removal of introns O Polysomes
Prokaryotic and eukaryotic RNAS differ in which of the following ways? FRNA molecules are only part of the prokaryotic ribosome Prokaryotic RNAS have non-coding sequences that are removed during processing O Eukaryotes have a pre-mRNA that requires splicing to create a functional transcript O Eukaryotes have simpler ribosomes, consisting of fewer FRNAS
The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop
Which of the following polypeptides (written from their N terminal ends) is encoded by the following mRNA? (hint: there is no left or write in a cell!) 3' GG AUG AGU AUA CUU ACG GGU GAA GUA CAU UAA CCC C5' O O O Met Lys Trp Ala Phe lle Met Ser lle Leu Thr Gly Glu Val His Tyr Lys Arg Thr Phe Tyr Met none of the above His Val Glu Gly Thr Leu lle Ser Met
An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding protein sequence
Prokaryotic cells can have more than one functional start codon per mRNA because There are multiple answers A prokaryotic promotes consist of two separated sequences: the -30 box and the -10 box B they make polycistronic RNA C both transcription and translation happen in the same cellular compartment D prokaryotic ribosomes bind to the Shine-Delgarno sequence E the activity of the lac repressor is regulated based on the physiologic condition of the cell
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger RNA, is required for proper attachment of the small ribosomal subunit to the mature mRNA molecule? polyadenylation at the 3’ end 7-methyl-guanosine capping at the 5’ end excision of introns formation of quadruple-stranded DNA splicing of exons
In eukaryotic cells, mRNA is modified in several ways. Match the mRNA modifications to their functions. 5' mRNA Cap Poly A Tail Introns Exons Choose [Choose] Depending on the length, this structure can help with mRNA stability. Portions of the mRNA that are spliced together to make a mature mRNA. Helps ribosomes attach to the mRNA. Portions of the mRNA that are removed before translation. [Choose] [Choose]