How can a drug influence the immune system? In your answer also include an example for  each process?

Q: What happens to a cell in the absence of meiotic recombination?

A: Meiosis is a kind of cell division involving the production of 4 daughter cells having half number…

Q: Observations in Visceral Muscle Observations in Skeletal Muscle Observations in Cardiac Muscle

A: Muscles are tissues that are present around the internal organs. They protect these delicate organs…

Q: Discuss the importance of international agreements in the management of biomedical waste

A: Biomedical waste: It is any waste that is generated during the diagnosis, treatment, and…

Q: A man, heterozygous for type B blood marries a woman with type A blood whose father was type O. What…

A: A man, heterozygous for type B blood marries a woman with type A blood whose father was type O. What…

Q: What happens when two amino acid molecules form a bond to build a protein? release of a carbon…

A: Introduction: Protein; Amino acids are arranged in a long chain and joined to one another by…

Q: rrect? Choose one: O A. After they shed their coats, ER vesicles fuse together in a process known as…

A: The fusion of membranes of the same compartment is known as homotypic fusion whereas the fusion…

Q: An E. coli colony grew on minimal medium supplemented with arginine and leucine. However, bacteria…

A: Introduction :- The coliform bacterium Escherichia coli, usually known as E. coli, belongs to the…

Q: our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3'…

A: A) One Sequence Read as per data: GTTACGCTTAGA B) One Sequence Contig: ACCGTCGGTTACGCTTAGATAACAAG

Q: Explain the RAAS mechanism.,!

A: RAAS is the renin-angiotensin axis or renin-angiotensin system is responsible for the regulation of…

Q: what were the specific skeletal evidence that implicates specific patterns of muscle activity that…

A: Introduction The interior skeleton of a person acts as the body's framework. This framework is made…

Q: Information on DNA can often indicate relatedness between organisms and even provide data on how…

A: The contemporary categorization system uses DNA to actuate an organism's heritage and ancestry, as…

Q: In a human population of Korfu16% of individuals are Rh-negative.  Assuming that this population is…

A: According to Hardy-Weinberg equilibrium the allele and genotype frequences will remain same…

Q: Liver cells are in contact with the blood and exchange a variety of substances with the blood plasma…

A: Plasma membrane is not permeable to all molecules. charge molecules are not permeable to plasma…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: A congenital defect mutates the genes that code for RAG1 & RAG2 making them unreadable (therefore no…

A:

Q: Both the isolation buffer and assay buffer that was used in isolation of mitochondria contained 0.3M…

A: The purpose of using mannitol at this concentration in isolation buffer  and assay buffer to…

Q: Crossing over is an event occurring during metaphase II. True False

A: Crossing over is a cellular process that happens during meiosis a special type of cell division that…

Q: Based on what you know on how ultrasound imaging works, what do you think will NOT look like a black…

A: Diagnostic ultrasound, also called sonography or diagnostic medical sonography, is an imaging method…

Q: _____ is the combination of a seat, elation, another modifications to the histones that allow for…

A: Epigenetics is the study of stable phenotypic changes which do not involve alterations in DNA…

Q: How do the fossils found at Coral Bluffs inform us about this diversification of the mammals?

A: Fossils are the dead remains of living organisms . Fossils play immense role in providing…

Q: Give 4 exercise with the he of anatomical terms in describing the position and positive effect of…

A: Physical exercise is a subpart of physical activity that is intended, structured, and redundant,…

Q: Do you think that most plant and animal cells are similar to does we observed today?

A: Since you have asked multiple questions we will answer the first question for you. If you want any…

Q: Discuss physiology of protozoan

A: Protozoans are the unicellular eukaryotic organisms that can be considered as free living or…

Q: Our lacrimal glands secret tears through the process glands secret saliva through the process O…

A: Endocytosis refers to a cellular process in which intake of substances is done by the cell. In this…

Q: Scientists IPed a mutant version of KDM3A with serine 264 altered to aspartic acid (dubbed S/D…

A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (the treatment of cells at 42°C…

Q: O W11 W11 W12 = W22 O W11 W12> W22 O W12> W11 = W22 O W11 = W22> W12

A: A branch of genetics called population genetics, which is related to evolutionary biology, examines…

Q: What are the applications of plant tissue culture?

A: Plant tissue culture It refers to the techniques that are used to preserve or develop plant cells,…

Q: how do unicellular differ from single cell multicellular organisms differ

A: Organisms are categorized into different types such as I) on the basis of nuclear membrane/nucleus…

Q: You have just started a rigorous exercise. Explain two different ways you can increase blood flow to…

A: Everyone requires physical activity and should be permitted to participate in their chosen…

Q: How might the environment influence whether a fungus reproduces sexually or asexually?

A: Fungi can reproduce sexually or asexually and the choice depends on the presence of environmental…

Q: Fill in the blanks: The two most common visual pigments (photosensitive pigments) of insects are…

A: A pair of large, black and kidney shaped compound eyes are located on the lateral side of head in…

Q: 4. Sketch a diagram of a plant cell and an animal cell. Label the parts to show how the two types of…

A: Animals and plants can be referred to as multicellular organisms, which means they each comprise of…

Q: Using zoonotic malaria, avian influenza and COVID-19 as examples, discuss the advantages and…

A: Various diseases spread through different means which makes them quite hard to control. The recent…

Q: 11. How are metaphase 12. If cells in the process of dividing are subjected to colchicine, a drug…

A:

Q: Cell body Effector Spinal nerve Central canal Dorsal root Interneuron Motor neuron Sensory neuron 14…

A: Neurones are the largest cell of our body which help in transmission of signal all over the body.

Q: The duplicated chromosomes are seen lined up in the center of the cell during prophase metaphase…

A: A sequence of various events take place when a cell starts to grown and divide, this series of…

Q: Compare and contrast between intrachromosomal translocation and unequal crossing over

A: The study of genomes' structure, functioning, evolution, sequencing, and editing is the emphasis of…

Q: True or false: the antigen binding site of an antibody is found in the variable region of the…

A: Introduction Immune system defense protein known as an antibody, or immunoglobulin, is created in…

Q: Why temperature decreases in mesosphere but with full explain.

A: Introduction :- The third layer of the atmosphere, the mesosphere, is situated just above the…

Q: Which basal transcription factor contains a subunit that causes local distortion in DNA so that…

A: ANSWER) The distortion in the DNA during transcription is produced by the one of the various factors…

Q: Why are fish gills the most efficient of all respiratory organs?

A: Introduction  The respiratory system, also known as the respiratory apparatus or ventilatory system,…

Q: Give two ways nature uses to hide differences between X- and Y-sperm in mammals?

A: The X and Y chromosomes are generally known as sex chromosomes. We know that when two X chromosomes…

Q: For the below mating, what proportion of offspring will be blood type 0? H/h; A/i* h/h; A/i A) 1/4…

A: The H gene is important for the expression of H antigen which is vital for the expression of A and B…

Q: You are studying a new species of insect. You identify the following about sex determination in this…

A: The genetic material is transmitted from parents to children. Mendelian inheritance refers to…

Q: The patient oresented with the complaint of chronic bronchitis. After the procedure was discussed…

A: CPT codes refer to the treatment being given. CPT is a acronym for Current Procedural Terminology.

Q: hat is chromosome disjunction and the effects of non-disjunction?

A: There are 46 chromosomes in a human cell and these are arranged in pairs so it can be set there are…

Q: Which of the following is NOT found in heterochromatin? O A. Centromeres OB. Most of the Y…

A: Introduction Heterochromatin, often known as condensed DNA or densely packed DNA, has several…

Q: A 19-year-old woman comes to the physician because of a 1-month history of mild fatigue and…

A: Haemoglobin electrophoresis is the blood test which is used to measure different types of…

Q: The word root erythr/o means?

A: We know that it is crucial for people to comprehend terminology particular to their chosen vocation.…

Q: has only one endplate, and ea mplitude greater than the thre tral neurons have hundreds a the EPSP…

A: Muscle end plate : The region of muscle fibres where the motar nerbes terminate on each skeleton…

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.