How u make it I want excel file or tell me how to make excel file now. U answered naa?? I will make in own Microsoft excel
Q: In what way are carbon-based compounds like children's Tinker Toys or Lego blocks? Give a few…
A: Carbon-based compounds are often compared to children's Tinker Toys or Lego blocks because carbon…
Q: Problem 1
A: The objective of this question is to identify the non-recombinant mice from a cross between FG/fg…
Q: What property makes phosphatidylcholine a good emulsifying agent whereas triglycerides are not?…
A: Phosphatidylcholine contain hydrophilic head group and hydrophobic tail group.
Q: Onlyqno3 solve. I. Given a polypeptide below, answer the following questions:…
A: Proteins are polymers of amino acid residues linked together via peptide bonds and folded into a…
Q: a) Based on the data shown in the image, what are the Km and Vmax for the enzyme with L-DOPA and…
A: Enzymes catalyse biochemical reactions by lowering their activation energy. Enzymes bind to their…
Q: The following amino acid is dissolved in solution at pH 7.4. HC H + CH CH₂ H H+ HC a. Which amino…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation:pH =…
Q: Some enzymes have catalytic activity only limited by diffusion. Which rate constants of an enzyme-…
A: Diffusion is the process by which molecules move from an area of higher concentration to an area of…
Q: If the membrane potential of a neuron drops to -55mV and sodium ions start to flow from outside to…
A: Concentration of ion gradients across a membrane and selective movements of ions along gradient…
Q: Draw the products of the reaction of xylulose-5-phosphate and erythrose-4-phosphate catalyzed by…
A: The Pentose Phosphate Pathway also known as the Hexose monophosphate shunt is a metabolic pathway…
Q: The cytochromes are heme-containing proteins that function as electron carriers in the mitochondria.…
A: The objective of the question is to calculate the difference in the reduction potential (ΔE°') and…
Q: List 4 major types of inhibition modes and clearly indicate the effect on Vmax and KM for each mode?
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Assume that an enzyme-catalyzed reaction follows the scheme shown: E + S ES E + P k₁ = 1 x 10%/M-s…
A: Michaelis Menten postulated that free enzyme reacts with the substrate reversibly to form an…
Q: Suppose a yeast enzyme performs this reaction: Glyceraldehyde 3 - phophospate (GAP or G3P) → 3- -…
A: Glycolysis is the metabolic pathway where glucose is catabolised into pyruvate with a net production…
Q: Give 2 differences between the lagging strand and the leading strand
A: DNA replication is the process by which the double stranded DNA (dsDNA) molecules are copied to…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: For the following reaction: HNO3 H2SO4 NO2 NO2 NO2 10% 8% 82% 1. Write a reasonable mechanism, using…
A: 1) isopropyl benzene is considered to be electron donating by positive inductive effect of its…
Q: The predicted thermodynamic yield for anaerobic oxidation of methane coupled to sulfate reduction is…
A: Comparing two Reverse Methanogenesis Mechanisms of Sulfate-Dependant Anaerobic Methane Oxidation…
Q: phosphorylation/dephosphorylation Diagram the cascade that regulates glycogen metabolism. Please use…
A: Glycogen synthesis is the process of synthesizing glycogen by polymerizing glucose. It is undertaken…
Q: Genetics 8 Q6
A: The objective of the question is to understand the possible outcomes of non-disjunction during the…
Q: Consider the following compounds. Sablabla CH3 H₂C H₂C CH3 2 3 Use the numbers shown to answer the…
A: Organic reactions can be defined as the reactions in which organic reactants react with each other…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options…
Q: Which irreversible inhibitor is also known as a substrate analog? affinity label transition-state…
A: Irreversible inhibitors play a crucial role in biochemical research and drug development by…
Q: What is the systematic IUPAC name of the following compound?…
A: for given compound,Option A is correct for systematic IUPAC nomenclature.Explanation:Step 1: In the…
Q: 1. In a study by Cameroni et al. (Nature, Dec. 2021), scientists analyzed the interaction between…
A: SARS-CoV-2 is an infectious virus that is responsible for the recent COVID pandemic. It is a…
Q: Show your calculations for determining the number of ATPs that would be generated from the aerobic…
A: The triglyceride in question is composed of ;a glycerol molecule (YELLOW)a 4 carbon saturated fatty…
Q: You are told to analyze the purity of your product with TLC. Which of the following TLC plates would…
A: The working principle of thin-layer chromatography is the same as column chromatography. A small…
Q: Problem 2
A: The objective of this question is to identify the recombinant offspring from a genetic cross between…
Q: Hypoglycin A, an amino acid derivative found in unripened lychee, is an acutely toxic compound that…
A: There are 20 different amino acids that exist in nature. They are involved in forming the protein…
Q: What is full name of the N-terminal amino acid residue? Just type the name (one word). What is the…
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers or…
Q: When the CAC is run in reverse by microorganisms that use it to fix carbon, the citrate synthase…
A: Kreb cycle is the reaction procews that operates in the mitochondria and it is followed by…
Q: Please draw out mechanism The formation of fructose 1, 6- biphophste from dihydroxyacetome phospahte…
A: Glycolysis:The metabolic process known as glycolysis, which in most organisms takes place in the…
Q: The protein catalase catalyzes the reaction 2 H,O,(aq) — 2 H₂O(1) + O₂(g) S and has a…
A: Reaction: 2H₂O₂(aq) → 2H2O(l) + O2(g)Km = 25 mMTurnover number Kcat = 4.0 × 107s–1Total enzyme…
Q: Describe the amino acid composition in terms of the general characteristics and comment on what the…
A: Proteins are made up of around 20 standard and a few non-standard amino acids. Depending on the…
Q: 10. A new protein of unknown structure has been purified. Gel filtration chromatography reveals that…
A: From the given data, we can deduce the following about the protein's tertiary and quaternary…
Q: Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed…
A: The free energy change for the malate dehydrogenase reaction of the TCA cycle is ≈21.122…
Q: 2.13 Calculate the reaction enthalpy, entropy, and free energy, AH°r, AS°r, and AGºr, for the…
A: Reaction thermodynamics is the energy things that occur during a chemical reaction together with a…
Q: identify the reactions of the citric acid cycle that provide reducing power for the…
A: The objective of the question is to identify the reactions in the citric acid cycle that generate…
Q: Question #4 The graph on the left shows data for an experiment in which isolated mitochondria were…
A: The process of oxidative phosphorylation, which mitochondria use to produce energy, is essential to…
Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…
A: Transition state theory states that as a substrate is converted into a product, a high energy state…
Q: What is the product of CH₂OH H-C-OH HO-C-H H-C-OH H-C-OH CH₂OH COOH H-C-OH HO-C-H I H-C-OH H-C-OH…
A: This is an example of reduction of a sugar with NADH/enzyme. The reaction of glucose with NADH is a…
Q: Draw the chemical structure for a phosphatidylethanolamine which contains trans, trans, cis-Δ10, Δ15…
A: I can describe the structure for you. The phosphatidylethanolamine molecule with trans, trans,…
Q: [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in…
A: Kreb cycleKreb cycle or citric acid cycle or tricarboxylic acid cycle (TCA) is a sequence of…
Q: 4nM 10 μΜ Ο 0.01 nM Ο Ο Ο 2 nM -2 nM
A: A Hill Plot is a type of graphical representation used in pharmacology and biochemistry to show how…
Q: A glucose molecule with its 3rd carbon radiolabelled underwent glycolysis. Which carbon atom in the…
A: During the process of glycolysis, glucose is broken down into pyruvate and energy, producing two…
Q: A) H H₂N-C-C <=0 CH2 OH ОН н D) H2N-C-C <=0 CH2 OH HO CH3 B) H₂N-C H3C-CH CH2 CH3 0= OH E) H2N-c-c С…
A: Amino acids are simply an alpha-carbon bonded to 4 different groups. The 4 groups are;an alpha-amino…
Q: When 10 micrograms of an enzyme with a molecular mass of 80,000 Daultons (grams/mol) is added to a…
A: Before going into the calculations for finding the turnover number (kcat), we need to convert…
Q: STEM Workplace Practices Q4
A: The objective of this question is to understand the difference between a product contaminant and a…
Q: 3) In his haste to create the chapter 2 homework assignment, the biochemistry professor quickly drew…
A: Amino acids are the building blocks of proteins. They have two functional groups . Amino group and…
Q: The image below is from what stage a) Prophase b) Interphase c) Telophase d) Metaphase e) Anaphase
A: Cell division typically involves two main stages: mitosis and cytokinesis. Here's a brief overview…
Q: Suppose you prepared one additional tube of albumin unknown and got an absorbance value of 1.99.…
A: For protein estimation,A standard curve must be constructed before the concentration of an unknown…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- https://www.youtube.com/watch?v=t0IngUYN2OA https://www.youtube.com/watch?v=pPxnIh_WTb8 1) Identify three positions of the patient to obtain a BP. 2) What problems can result from high blood pressure Or (HYPERTENSION)? 3) What problems can result from low blood pressure OR (HYPOTENSION)? 4) What IS the effect of exercise on BP? How does the body benefit from this change in BP during exercise? 5) How would the BP of an anxious patient visiting a doctor be different than if the patient is calm? 6) In atherosclerosis, plaque builds up inside the arteries. How would this affect BP? Is this an example of hypertension or hypotension? Part 2: The circulatory system has 5 functions. · Highlight the statements below that are only functions of the circulatory system. It carries cells that help to fight diseases. It gives structure and support to the body. It carries waste products to the urinary system. It carries carbon dioxide from cells…What type of therapy could you take if you had Fragile X syndrome and how does the threapy reduce the symptons caused by loss of FMRP?https://www.youtube.com/watch?v=t0IngUYN2OA https://www.youtube.com/watch?v=pPxnIh_WTb8 Part1 1) How would the BP of an anxious patient visiting a doctor be different than if the patient is calm? 2) In atherosclerosis, plaque builds up inside the arteries. How would this affect BP? Is this an example of hypertension or hypotension? Part 2: The circulatory system has 5 functions. · Highlight the statements below that are only functions of the circulatory system. It carries cells that help to fight diseases. It gives structure and support to the body. It carries waste products to the urinary system. It carries carbon dioxide from cells to the lungs. It maintains body posture. It carries nutrients from the digestive system to other cells. It carries oxygen from the lungs to other cells. · The list gives some structures in the blood and circulatory system. Heart, artery, red blood cell, ventricle, capillary, plasma, vein, white blood…
- The follwoing location is the sponal nerve: select one: a b c d e f g h2.A. 1. 2. 3. 4. |||| ential (mv) 13. State the channels involved in an action potential in cardiac AUTORHYTHMIC cells, which ion moves across the channel, which direction each ion moves across the channel when the channel opens, the approximate membrane potential at which the channel is fully open. +20 !!| CE - | Channel AaBbCcDdEe AaBbCcD. AaBBCEDE Aal Emphasis Heading 1 Normal lon? Influx or Efflux? 14. Define the term pacemaker potential (=drifting potential) and be able to identify it when given a graph of an action potential in an autorhythmic cell such as the one below. I Membrane Potential at which channel opens or is fully open (mv)In the Anesthesia section, we will learn some unique types of codes, including physical status modifiers and qualifying circumstances modifiers. What are these modifiers and why are they used?
- In your point of view as a senior high school stem student, How will you raise an awareness on the seriousness of this disease called hypertension?Fill in the following blanks (a - f) regarding the Baroreceptor Reflex Control: The baroreceptor reflex control is a negative feedback loop. If the patient is hypotensive, they are experiencing a decrease in blood pressure detected by (a.)_ located in the aortic and carotid bodies. The afferent pathways include the (b.)_ nerve and the (c.)__ nerve. These synapse at the cardioregulatory and vasomotor integration centers located in the (d.)_ These centers will cause the heart rate to (e.)(increase/decrease) and blood vessels to (f.) (vasodilate/vasocontrict). For the toolbar press ALT+510 (BC) or ALTHEN±+510/MadIs there a difference in the absolute values of force generated by females and male in EMG? Yes or No What might explain differences in force between genders?
- The HLA system is important in medicine for two major reasons. What are they?Hello, can you hel me quth this question please: "can you comment on the role of Hypertension and Stroke? How does HTN contribute to stroke?" Thanks in advance!The short horizontal line between the P wave and the QRS complex indicates that a-depolarization is moving slowly through the AV Node b-the atria are done contracting c-the ventricles are depolarizing d-the ventricles are contracting and ejecting blood