Homework Help is Here – Start Your Trial Now!
Science
Biology
How to identify the start site for transcription

How to identify the start site for transcription

Biochemistry
Biochemistry
6th Edition
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Reginald H. Garrett, Charles M. Grisham
Chapter29: Transcription And The Regulation Of Gene Expression
Section: Chapter Questions
Problem 1P
See similar textbooks
icon
Related questions
Question

 Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.

GACTATATCCGGCGTATGAAGAAGGTTTCTACGCTTGACCTGTTGTTCGTTGCGATCATGGGTGTTTCGC
CGGCCGCTTTTGCCGCCGACCTGATCGACGTGTCCAAACTCCCCAGCAAGGCTGCCCAGGGCGCGCCCGG
CCCGGTCACCTTGCAAGCCGCGGTCGGCGCTGGCGGTGCCGACGAACTGAAAGCGATCCGCAGCACGACC
CTGCCCAACGGCAAGCAGGTCACCCGCTACGAGCAATTCCACAACGGCGTACGGGTGGTCGGCGAAGCCA
TCACCGAAGTCAAGGGTCCCGGCAAGAGCGTGGCGGCGCAGCGCAGCGGCCATTTCGTCGCCAACATCGC
TGCCGACCTGCCGGGCAGCACCACCGCGGCGGTATCCGCCGAGCAGGTGCTGGCCCAGGCCAAGAGCCTG
AAGGCCCAGGGCCGCAAGACCGAGAATGACAAAGTGGAACTGGTGATCCGCCTGGGCGAGAACAACATCG
CCCAACTGGTCTACAACGTCTCCTACCTGATTCCCGGCGAGGGACTGTCGCGGCCGCATTTCGTCATCGA
CGCCAAGACCGGCGAAGTGCTCGATCAGTGGGAAGGCCTGGCCCACGCCGAGGCGGGCGGCCCCGGCGGC
AACCAGAAGATCGGCAAGTACACCTACGGTAGCGACTACGGTCCGCTGATCGTCAACGACCGCTGCGAGA
TGGACGACGGCAACGTCATCACCGTCGACATGAACAGCAGCACCGACGACAGCAAGACCACGCCGTTCCG
CTTCGCCTGCCCGACCAACACCTACAAGCAGGTCAACGGCGCCTATTCGCCGCTGAACGACGCGCATTTC
TTCGGCGGCGTGGTGTTCAAACTGTACCGGGACTGGTTCGGCACCAGCCCGCTGACCCACAAGCTGTACA
TGAAGGTGCACTACGGGCGCAGCGTGGAGAACGCCTACTGGGACGGCACGGCGATGCTCTTCGGCGACGG
CGCCACCATGTTCTATCCGCTGGTGTCGCTGGACGTGGCGGCCCACGAGGTCAGCCACGGCTTCACCGAG
CAGAACTCCGGGCTGATCTACCGCGGGCAATCAGGCGGAATGAACGAAGCGTTCTCCGACATGGCCGGCG
AGGCTGCCGAGTTCTATATGCGCGGCAAGAACGACTTCCTGATCGGCTACGACATCAAGAAGGGCAGCGG
TGCGCTGCGCTACATGGACCAGCCCAGCCGCGACGGGCGATCCATCGACAACGCGTCGCAGTACTACAAC
GGCATCGACGTGCACCACTCCAGCGGCGTGTACAACCGTGCGTTCTACCTGTTGGCCAATTCGCCGGGCT
GGGATACCCGCAAGGCCTTCGAGGTGTTCGTCGACGCCAACCGCTACTACTGGACCGCCACCAGCAACTA
CAACAGCGGCGCCTGCGGGGTGATTCGCTCGGCGCAGAACCGCAACTACTCGGCGGCTGACGTCACCCGG
GCGTTCAGCACCGTCGGCGTGACCTGCCCGAGCGCGTTGTAA

This question involves using a database. You will use a database for storage and mining of genome sequences. The procedure to identify the gene and the protein that it encodes is as follows:

  1. How to identify the start site for transcription?

 used EXPASY WEBsite translated this DNA sequence, as the IMAGE shown, there are genetic code is translated. i think I am doing wrong? 

2. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence

Should I copy the letter which is highlitend RED, which is start site, and then past it to BLAST? 

 

ttacaacgcgctcgggcaggtcacgccgacggtgctgaacgcccgggtgacgtcagccgc L Q R A R AGH A D G AER PGD VS R cgagtagttgcggttctgcgccgagcgaatcaccccgcaggcgccgctgttgtagttgct RV VA V L R R A N H PA GA A V V V A ggtggcggtccagtagtagcggttggcgtcgacgaacacctcgaaggccttgcgggtatc GG G P V VA V G V DEH LEG LAGI ccagcccggcgaattggccaacaggtagaacgcacggttgtacacgccgctggagtggtg PARR I G Q Q VERT V V HA A G V V cacgtcgatgccgttgtagtactgcgacgcgttgtcgatggatcgcccgtcgcggctggg HV DA V V V L R R V VDG SPVA A G ctggtccatgtagcgcagcgcaccgctgcccttcttgatgtcgtagccgatcaggaagtc LV HVA QRTA A LLD V VAD QE V gttcttgccgcgcatatagaactcggcagcctcgccggccatgtcggagaacgcttcgtt VLA A HI E L GS LA GHV GERF V cattccgcctgattgcccgcggtagatcagcccggagttctgctcggtgaagccgtggct HSA - L P A V D Q P G V L L G E A VA gacctcgtgggccgccacgtccagcgacaccagcggatagaacatggtggcgccgtcgcc DL VG RH V Q R H Q R I E H G G A VA gaagagcatcgccgtgccgtcccagtaggcgttctccacgctgcgcccgtagtgcacctt EEHR RAV P V G V LHA A P V V HL catgtacagcttgtgggtcagcgggctggtgccgaaccagtcccggtacagtttgaacac HV Q L V G Q R A GAEP V P V Q FEH cacgccgccgaagaaatgcgcgtcgttcagcggcgaataggcgccgttgacctgcttgta HA A E E MR V V Q R R I G A V D L L V ggtgttggtcgggcaggcgaagcggaacggcgtggtcttgctgtcgtcggtgctgctgtt GV GRAGE AERR GLA V VGA A V catgtcgacggtgatgacgttgccgtcgtccatctcgcagcggtcgttgacgatcagcgg HV D G D D VA V V HLA A V V D D QR accgtagtcgctaccgtaggtgtacttgccgatcttctggttgccgccggggccgcccgc TV VAT V G VLA D L L VA A G A AR ctcggcgtgggccaggccttcccactgatcgagcacttcgccggtcttggcgtcgatgac LGV G Q AFP LI E H F A G L G V D D gaaatgcggccgcgacagtccctcgccgggaatcaggtaggagacgttgtagaccagttg
Transcribed Image Text:ttacaacgcgctcgggcaggtcacgccgacggtgctgaacgcccgggtgacgtcagccgc L Q R A R AGH A D G AER PGD VS R cgagtagttgcggttctgcgccgagcgaatcaccccgcaggcgccgctgttgtagttgct RV VA V L R R A N H PA GA A V V V A ggtggcggtccagtagtagcggttggcgtcgacgaacacctcgaaggccttgcgggtatc GG G P V VA V G V DEH LEG LAGI ccagcccggcgaattggccaacaggtagaacgcacggttgtacacgccgctggagtggtg PARR I G Q Q VERT V V HA A G V V cacgtcgatgccgttgtagtactgcgacgcgttgtcgatggatcgcccgtcgcggctggg HV DA V V V L R R V VDG SPVA A G ctggtccatgtagcgcagcgcaccgctgcccttcttgatgtcgtagccgatcaggaagtc LV HVA QRTA A LLD V VAD QE V gttcttgccgcgcatatagaactcggcagcctcgccggccatgtcggagaacgcttcgtt VLA A HI E L GS LA GHV GERF V cattccgcctgattgcccgcggtagatcagcccggagttctgctcggtgaagccgtggct HSA - L P A V D Q P G V L L G E A VA gacctcgtgggccgccacgtccagcgacaccagcggatagaacatggtggcgccgtcgcc DL VG RH V Q R H Q R I E H G G A VA gaagagcatcgccgtgccgtcccagtaggcgttctccacgctgcgcccgtagtgcacctt EEHR RAV P V G V LHA A P V V HL catgtacagcttgtgggtcagcgggctggtgccgaaccagtcccggtacagtttgaacac HV Q L V G Q R A GAEP V P V Q FEH cacgccgccgaagaaatgcgcgtcgttcagcggcgaataggcgccgttgacctgcttgta HA A E E MR V V Q R R I G A V D L L V ggtgttggtcgggcaggcgaagcggaacggcgtggtcttgctgtcgtcggtgctgctgtt GV GRAGE AERR GLA V VGA A V catgtcgacggtgatgacgttgccgtcgtccatctcgcagcggtcgttgacgatcagcgg HV D G D D VA V V HLA A V V D D QR accgtagtcgctaccgtaggtgtacttgccgatcttctggttgccgccggggccgcccgc TV VAT V G VLA D L L VA A G A AR ctcggcgtgggccaggccttcccactgatcgagcacttcgccggtcttggcgtcgatgac LGV G Q AFP LI E H F A G L G V D D gaaatgcggccgcgacagtccctcgccgggaatcaggtaggagacgttgtagaccagttg
5 https://web.expasy.org/translate/ Translate is a tool which allows the translation of a nucleotide (DNA/RNA) sequence to a protein sequence. DNA or RNA sequence gactatatccggcgtatgaagaaggtttctacgcttgacctgttgttcg ttgcgatcatgggtgtttcgccggccgcttttgccgccgacctgatcg acgtgtccaaactccccagcaaggctgcccagggcgcgcccggc ccggtcaccttgcaagccgcggtcggcgctggcggtgccgacgaa ctgaaagcgatccgcagcacgaccctgcccaacggcaagcaggt cacccgctacgagcaattccacaacggcgtacgggtggtcggcg aagccatcaccgaagtcaagggtcccggcaagagcgtggcggc gcagcgcagcggccatttcgtcgccaacatcgctgccgacctgcc gggcagcaccaccgcggcggtatccgccgagcaggtgctggccc Genetic codes - See NCBI's genetic codes Standard reset Results of translation Translate tool TRANSLATE! . 3'5' Frame 1 Output format O Verbose: Met, Stop, spaces between residues O Compact: M, -, no spaces O Includes nucleotide sequence Includes nucleotide sequence, no spaces Open reading frames are highlighted in red • Select your initiator on one of the following frames to retrieve your amino acid sequence DNA strands O forward ✔reverse Download all the translated frames ttacaacgcgctcgggcaggtcacgccgacggtgctgaacgcccgggtgacgtcagccgc LQRA RAG HAD GAER PGD VS R cgagtagttgcggttctgcgccgagcgaatcaccccgcaggcgccgctgttgtagttgct R V 17 A V T R R A N H PAG A A D V V A
Transcribed Image Text:5 https://web.expasy.org/translate/ Translate is a tool which allows the translation of a nucleotide (DNA/RNA) sequence to a protein sequence. DNA or RNA sequence gactatatccggcgtatgaagaaggtttctacgcttgacctgttgttcg ttgcgatcatgggtgtttcgccggccgcttttgccgccgacctgatcg acgtgtccaaactccccagcaaggctgcccagggcgcgcccggc ccggtcaccttgcaagccgcggtcggcgctggcggtgccgacgaa ctgaaagcgatccgcagcacgaccctgcccaacggcaagcaggt cacccgctacgagcaattccacaacggcgtacgggtggtcggcg aagccatcaccgaagtcaagggtcccggcaagagcgtggcggc gcagcgcagcggccatttcgtcgccaacatcgctgccgacctgcc gggcagcaccaccgcggcggtatccgccgagcaggtgctggccc Genetic codes - See NCBI's genetic codes Standard reset Results of translation Translate tool TRANSLATE! . 3'5' Frame 1 Output format O Verbose: Met, Stop, spaces between residues O Compact: M, -, no spaces O Includes nucleotide sequence Includes nucleotide sequence, no spaces Open reading frames are highlighted in red • Select your initiator on one of the following frames to retrieve your amino acid sequence DNA strands O forward ✔reverse Download all the translated frames ttacaacgcgctcgggcaggtcacgccgacggtgctgaacgcccgggtgacgtcagccgc LQRA RAG HAD GAER PGD VS R cgagtagttgcggttctgcgccgagcgaatcaccccgcaggcgccgctgttgtagttgct R V 17 A V T R R A N H PAG A A D V V A
Expert Solution
steps

Step by step

Solved in 4 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Follow-up Questions
Read through expert solutions to related follow-up questions below.
Follow-up Question

I am more confused. how about we start from begining, you post answers on here, and then we go from there? 

1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source.

2. "Look carefully at the DNA sequence and identify the start site for transcription"

3.

  1. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence.
  2. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein).
  3. Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any parameters in the boxes before you click BLAST.
  4. When the search is complete, you will have a figure showing the most homologous results or “sequences producing significant alignments”; and, after that, a list of what these proteins are. Your protein will be the first one on the list. You can click on the accession number or sequence identifier information to bring up more information. You should be able to find the name, function, size (number of amino acids), and source (name of the organism) for the protein. Your answer should include the:amino acid sequence of the protein
  5. size of the protein: NCBI reference sequence WP_0031138351 CONSISTE 498 amino acids long
  6. identity of the protein: multispecies, M4 family elastase LasB ( Pseudomonas)
  7. function of the protein (you may need to do additional online research to find this)

  8. bacteria Pseudomonas aeruginosa. Its main function is to break down elastin which is a component of the connect tissue in human. This enzyme helps the bacteria to invade tissues and cause infections by degrading elastin in the host tissue. LasB has also been shown to cleave a variety of other host proteins including immunoglobulins, complement components, and coagulation factors, which further contributes to the pathogenesis of Pseudomonas infections. In addition to its virulence factors, LasB also has industrial and biotechnological applications due to its proteolytic activity.(PubMed)

Solution
Bartleby Expert
SEE SOLUTION
Follow-up Question

Identify the open reading frame in the following DNA sequence

Solution
Bartleby Expert
SEE SOLUTION
Follow-up Question

Can you show me the step how you get the amino acid sequence? 

Solution
Bartleby Expert
SEE SOLUTION
Follow-up Question

what is the amino acid squence of the protein? 

Solution
Bartleby Expert
SEE SOLUTION
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS