(üij If one of the strands of DNA has thefollowing sequence of bases runningin the 5' →3' direction5'-G-G-A-C-A-A-T-C-T-G-C-3'3'e c 4 GT TAGA C GSvhat base is 'closes: to 5' end in thecompiementary strand?

Name: (üij If one of the strands of DNA has thefollowing sequence of bases
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: (üij If one of the strands of DNA has thefollowing sequence of bases runningin the 5' →3' direction5'-G-G-A-C-A-A-T-C-T-G-C-3'3'e c 4 GT TAGA C GSvhat base is 'closes: to 5' end in thecompiementary strand?

Answered: Image /qna-images/answer/2b4c48e0-80d7-4394-8564-64ecaad0a022.jpg

Science

Biology

(iij If one of the strands of DNA has the following sequence of bases running in the 5'3' direction 5'-G-G-A-C-A-A-T-C-T-G-C-3' 3'e CTSTTAGACG5 what base is closes: to 5' end in the compiementary strand?

(iij If one of the strands of DNA has the following sequence of bases running in the 5'3' direction 5'-G-G-A-C-A-A-T-C-T-G-C-3' 3'e CTSTTAGACG5 what base is closes: to 5' end in the compiementary strand?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...

See similar textbooks

Similar questions

The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY
If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'
One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. 5'- What special type of sequence is contained in this DNA segment? Hoogsteen pairing major groove O palindrome mirror repeat What alternative structure does the double-stranded DNA have the potential to form? B-DNA O a G tetraplex triplex DNA a cruciform Z-form DNA
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'
Pues (two-ringed) 9. (a) Label each nitrogenous base in the double strand of DNA in Figure 4. NEL P-C.₂. H- (a) -CH₂-P-C₂ 5' 0 PCH₂ (b) -Н -CH₂-P-C₂ 5' 0 PCH₂ CH₂-P-C₂ H 0 I' P 5' 0 (d) 3' CH₂ H PCH₂ Figure 4 (b) Figure 4 above shows a phosphodiester bond. Explain what this is. 1.5 Pr
Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)
2. Predict the following sequences of base in the DNA strands complementary to the single RNA strand: • 3'A-G-T-C-G-T-A-C-A-T-G 5 • 5'G-T-C-G-T-A-C-T-A-G-C 3' • 5'C-A-T-G-C-T-A-G-C-T-A 3' • 3'A-T-C-A-T-G-C-G-T-A-C 5' • 5'T-G-A-C-G-T-A-C-G-A-T 3
5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5'-GGCAACGGTCCAGTCCAAGTTACG-3' 6. What are the amino acids coded for by this sequence of nucleotides: ATG GGA ACT CCA 7. What is the complementary messenger-RNA sequence for the DNA sequence shown below? ATC GGA CCG ATT GCC