In a survey of 1,150 women who gave birth in China in 2000, a total of 500 reported that they took multivitamin during the month before becoming pregnant. Calculate the prevalence (expressed in percentage) of in this group of multivitamin takers
Q: Name the reproductive and non-reproductive parts of bread mould (Rhizopus).
A: Bread mould is a type of fungus that can grow on bread. The mould is made up of tiny spores that…
Q: Can you think of anything that would prevent mitosis from occurring in a new cell whose genome is…
A: Introduction: The primary purpose of mitosis, a kind of cell division, is to create duplicate cells…
Q: Describe a mechanism by which a gene could move from the bacterial genome to a plasmid in the same…
A: An asexual method of bacterial reproduction is called binary fission. The bacteria split in two,…
Q: Citrus × microcarpa
A: citrus × microcarpa, commonly known as calamondin or orange calamondin is a small , bushy, evergreen…
Q: QUESTION 2 In a Phenome-wide Association Study (PheWAS) where we are trying to link genotypes and…
A: Phenome-wide association studies (PheWAS) searches for phenotypes that is associated with specific…
Q: Draw the chart, demonstrating the mechanisms action of epinephrine on target cells (the typical…
A: Epinephrine It refers to a hormone that plays an important role in the fight-or-flight response of…
Q: What are the confounding factors? Indicate how you would assign the pigs to the treatments. Are…
A: Confounding variable A variable that affects both the dependent and independent variables but is…
Q: 63. Which of the following labeled cells in the photomicrograph shown synthesizes antimüllerian…
A: Anti-mullerian hormone (AMH) AMH is essential for the development of a fetus's sex organs in the…
Q: Which of the following is also called a CD8 or killer T cell? Macrophage B lymphocyte Ohelper T…
A: Introduction:- A complex system consisting of different cells and organs that protects our body by…
Q: Future Uses of Citric Acid in Biotechnology
A: As defined by the National Institutes of Health, biotechnology is a broad field of biology that…
Q: 2 Wolves are introduced into the park → The number of elk calves born to every 100 female elk …
A: Territoriality(space) can help to control population increase; an animal's home range is the region…
Q: Which of the following is not true of cancer cells? Select one: O a. they release a growth factor…
A: The one criteria amongst following sentences, that is not true about Cancerous cells is : ( e ) :…
Q: Pregnant patients are encouraged to perform kegs exercises
A: Kegel exercises involve clenching and releasing your pelvic floor muscles. The pelvis holds your…
Q: The fruit color of eggplants is an example of incomplete dominance since crossing deep purple…
A: The fruit color of egg plant depicts incomplete dominance. Let P allele encodes purple color. It is…
Q: Describe the characteristics of the garden pea that made it a good organism for Mendel's analysis of…
A: Mendel's basic theories of inheritance made it easier to comprehend how traits are passed down from…
Q: After a heavy meal Jane was strolling the streets of She came across bakery, and she could smell…
A: Introduction Smell is one of the important senses of the five senses of our body. The olfactory…
Q: How does this organism move?
A: When Monocystis is young, it is an intracellular parasite that lives in the bundle of developing…
Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…
A: Transcription and translation are terms used to describe two distinct biological processes: the…
Q: For these organisms to develop into functional offspring of that species, which one of the following…
A: Introduction Embryology is a branch of science which deals with the study of embryonic development.…
Q: Why is erythropoietin a popular drug among athletes? Explain with the physiological mechanism. BIUG…
A: The primary hormone controlling red blood cell (RBC) formation is erythropoietin (EPO). Recombinant…
Q: Identify the plant seen below common name
A: Plant kingdom includes bryophytes, pteridophytes, angiosperms and gymnosperms. The bryophytes lack…
Q: Y-linked 이마 In the pedigree shown, indicate whether each of the following inheritance patterns is…
A: Autosomal dominant are effected parent in l generation. Y linked traits are related
Q: what is the parental genotype: female___ x___ male?
A: This experiment involves the biochemical assay to check the inheritance of the gene that encodes for…
Q: Transcribe the strand below: ACGCTACCGTTAGCCGACATCGGGGACACTGACTCG
A: A DNA fragment is copied into RNA during transcription. Messenger RNA is the term for DNA segments…
Q: Will the cortisol influence on the target cells if to block their membranes receptors? Explain your…
A: Transmembrane proteins include membrane receptors. These are utilised to send signals from the…
Q: Can you suggest a possible hypothesis? What is/are the dependent variable(s)? What is/are the…
A: As per the Q&A guidelines, we are supposed to answer only three sub-parts. Please repost the…
Q: 1. If you start going to the gym and increase your muscle mass, your % of body fluids will a.…
A: The muscles may also hold onto fluid and develop a mild inflammation as a defence mechanism against…
Q: CLASS AMPHIBIA-SALAMANDERS, FROGS, & TOADS The hind limbs of the frog are much longer than the…
A: A frog is a tailless, short-bodied amphibian belonging to the big carnivorous group of species. A…
Q: "To guarantee that the antigen-presenting cells in the thymus will display a complete repertoire of…
A: Antigen-presenting dendritic cells are found in tissues that are directly exposed to the outside…
Q: Orrorin tugenesis may be the earliest hominin because it has a thigh bone that the discoverers say…
A: Orrorin tugenensis, who lived around 6 million years ago, is one of the oldest early humans on our…
Q: IgA Proteases are enzymes that... destroy antibodies in mucus secretions cause blood to clot break…
A: Enzymes like IgA proteases are secreted by the pathogenic bacteria like Streptococcus pneumoniae,…
Q: In some fruits, the floral parts are persistent even up to maturity. Identify these parts. Consider…
A: Introduction Flower is the reproductive part of the plants. Sometimes it has both male and female…
Q: U.We can largely (more than 50 %) reduce the risk of cancer if we carefully avoid smoking,…
A: Cancer can be described as a group of diseases,in which cell lost the usual control over their…
Q: 1. Determine the anataomy and somatosensory receptors of the skin. 2. Describe the receptors…
A: The skin is the biggest organ in the body. It completely envelops the body. It functions as a…
Q: A recent metagenomic study analyzed the microorganisms present on surfaces within the entire subway…
A: Introduction: Microorganisms are tiny, microscopic organisms that are found both within and outside…
Q: In immunofluorescence experiments, what is the role of the primary and secondary antibodies? (select…
A: A standard laboratory method known immunofluorescence (IF) relies on the employment of certain…
Q: Adaptive immunity can be divided into four distinct classifications, describe each: natural active…
A: Immunity can be defined as a ability of the body of an organism to resist the infections by…
Q: Rarely, both sister chromatids of a replicated chromosome end up in one daughter cell. How might…
A: Mitosis is a cell division in which one mother cell will divides into two new daughter cells which…
Q: Why living trees do not rot, but decay at a rapid rate once they are dead.
A: Introduction: By breaking down complex organic materials from trees or plants into simpler…
Q: What to pyrogens do? initiate fever initiate cell division initiate vasodilation initio
A: Pathogens enters within the host body and initiats several changes. The immune system of host also…
Q: Why do you think Linnaeus considered the flower as the most variable reliable basis for plant…
A: Introduction: Carl Linnaeus (1707-1778) was a Swedish botanist, zoologist, and physician who…
Q: Are there any differences in morphology between monocot and dicot fruits? Tabulate these differences…
A: Morphology means the angiosperm show such a large diversity in external structure like it's all…
Q: A colleague asks his friend, a technologist, for the results of his girlfriend’s pregnancy test. The…
A: A medical technologist is a person who conducts expert laboratory work while complying with…
Q: to study a presumed inverse relationship between black tea consumption and cardiovascular disease,…
A: Given: Randomly selected sample=13,500 Age =50-64 Duration =January 2021 and September 2021 To…
Q: a practical investigation to find the solute potential of rhubarb cells was carried out in this way.…
A: The plasma membrane, also known as the cell membrane, is the membrane that divides the inside of the…
Q: 16- A population's carrying capacity ____. a- increases as per capita growth rate (r) decreases…
A: The collection of all the individuals of same species in a particular area that interact with each…
Q: why aglaonema "big roy" mutasi has a color combination of greens, orange and pinkish.
A: Every plant has pigments present. If the pigments are few in number then the colours will be…
Q: Which of the following reactions does not occur mammals? O pyruvate + NADH-lactate + NAD+ O…
A: Introduction : All chemical processes necessary to keep cells and an organism in a live state…
Q: DIHYBRID CROSS Heterozygous Yellow and heterozygous round seed crossed with homozygous yellow and…
A: Alleles for both parents - A. Y for yellow seed and y for green seed B. R for round seed and r for…
Q: 1.where we can we find the circle of willis in 10 mm pig embryo?what are the branches associated…
A: 1.The circle of Willis is mainly a vascular network.Basically,the circle of Willis is a part of the…
In a survey of 1,150 women who gave birth in China in 2000, a total of 500 reported that they took multivitamin during the month before becoming pregnant. Calculate the prevalence (expressed in percentage) of in this group of multivitamin takers.
Step by step
Solved in 2 steps with 1 images
- For items 6-13 use the problem set below.A cohort study looks at the relationship between estrogen use and the risk of breast cancer. A total of 4555 estrogen users and 4495 nonusers are enrolled in the study and followed up for 15 years for the developmentof breast cancer. In the estrogen-using group, 212 women developed breast cancer, and in the non-using group, 298 women developed breast cancer. 6. What is the risk of breast cancer in the exposed group?A. 4.65% B. 4.66% C. 6.63% D. 6.65% 7. What is the risk of breast cancer in the unexposed group?A. 4.65% B. 4.66% C. 6.63% D. 6.65% 8. What is the overall risk of breast cancer?A. 4.64% B. 5.63% C. 5.64% D. 6.63%“The overall absolute increase in breast cancers diagnosed among current and recent users of any hormonal contraceptives was 13 (95% CI, 10 to 16) per 100,000 person-years, or approximately 1 extra breast cancer for every 7690 women using hormonal contraception for 1 year”. What is the term used in epidemiology which describes this sentence? Please calculate this number and comment on its magnitude.A cohort study looks at the relationship between estrogen use and the risk of breast cancer. A total of 4555 estrogen users and 4495 nonusers are enrolled in the study and followed up for 15 years for the development of breast cancer. In the estrogen-using group, 212 women developed breast cancer, and in the non-using group 298 women developed breast cancer. 9. What is the computed relative risk for breast cancer developed among estrogen users?A. 0.591 B. 0.613 C. 0.702 D. 0.833 Property of and for the exclusive use of SLU. Reproduction, storing in a retrieval system, distributing, uploading or posting online, or transmitting in any form or byany means, electronic, mechanical, photocopying, recording, or otherwise of any part of this document, without the prior written permission of SLU, is strictlyprohibited. 210. What is the most appropriate scale of measurement to be used based on the given problem set?A. Risk ratioB. Odds ratioC. Absolute riskD. Cumulative incidence11. How many…
- A case-control study was conducted to evaluate the relationship between physical activity and coronary heart disease (CHD) in men. A total of 406 men newly diagnosed with CHD were included together with 406 men of similar ages who did not have CHD. The risk of CHD (measured by the OR) was higher among men who were inactive or only moderately active (collectively called ‘inactive’) than among those who were physically active: (See attached image) Odds ratio for inactive men compared to active men= (299 x 136)/(270 x 107)=1.41Suppose there is no misclassification in these data.What would the observed OR have been... 1. If 20% of all the inactive men had been misclassified as active? 2. If 10 % of inactive cases had been misclassified as active?Calculate the age standardized IHD mortality rate using the Standard population. Show all calculations. (See attached image)A case-control study was conducted to examine the risk factors for HPV infection among OB/GYN clinic patients. The researcher hypothesized that women with HPV cases will report a greater number of multiple sexual partners compared to controls. The existing literature indicates that cases (women with HPV infection) without delay tend to recall and report accurate information about their sexual partners. On the other hand, recall and report of accurate information about multiple sexual partners among controls may not be as clear. (1) Define the direction and the type of biases in the following examples. Choose only one answer for each question. This is study is liable to the following bias: a) Confounding b) Selection Bias c) Information Bias (2) The relationship between HPV infection and the number of sexual partners is likely to be:a) Can go either direction b) Under-estimated c) Over-stimated (3) The following are examples of bias except: a) Confounding…
- You conduct a case-control study in Portland pediatric clinics to evaluate the relationship between the exposure of exclusive breastfeeding for at least the first 6 months of life, and the outcome of no ear infections during the first year of life. The exposure is “exclusive breastfeeding” (as opposed to mixed feeding or formula feeding. The outcome of interest is “no ear infections during the first year of life” (as opposed to having at least one ear infection). Your study produces an OR of 0.3, relating exposure and outcome. Assuming that the 95% Confidence Interval indicates your result is statistically significant, the interpretation for the OR in your study is: A. The odds of exclusive breastfeeding among children with no ear infections during the first year of life is 0.3 times that of those with at least one ear infection during the first year of life. B.The odds of no ear infections during the first year of life among exclusively breastfed children is 0.3 times the odds…Discuss at least 3 cardiovascular diseases (CVD) risk factors that can be modified. How do factors such as the intrauterine environment, menopause, oral contraceptives use, and stress affect CVD risk factors?Davies-Tuck, M.L., Wallace, E.M., Davey, MA. et al. Planned private homebirth in Victoria 2000–2015: a retrospective cohort study of Victorian perinatal data. BMC Pregnancy Childbirth 18, 357 (2018). https://doi.org/10.1186/s12884-018-1996-6 What is the inclusion and exclusion criteria of this study
- What is the expected effect on reproduction on an individual with hormone levels shown above? Identify two physiological changes that will not occur due to the atypical hormone levels shown above. The graph below shows the estrogen and progesterone levels of an individual during a menstrual cycle of 28 days. The top light blue line indicates the progesterone levels and the bottom purple line indicates the estrogen levels. This individual is in luteal phase.This individual can be expected to have low levels of FSH and LH.For each statement in the left column, select the answer which best matches. frequency of occurrence increases as the age of the mother increases 1. galactosemia can be controlled by administration of a special diet 2. sickle cell anemia occurs with higher frequency in 3. Down syndrome the Jewish population than in the U.S. population as a whole 4. Tay-Sachs disease abnormal hemoglobin moleculesA cohort study looks at the relationship between estrogen use and the risk of breast cancer. A total of 4555 estrogen users and 4495 nonusers are enrolled in the study and followed up for 15 years for the development of breast cancer. In the estrogen-using group, 212 women developed breast cancer, and in the non-using group 298 women developed breast cancer. 12. How many were unexposed and not diseased?A. 4555 B. 4495 C. 4197 D. 434313. Which of the following interpretation is TRUE based on the results obtained?A. Use of estrogen increases the risk of developing breast cancerB. Use of estrogen is a protective factor to developing breast cancerC. Use of estrogen is a risk to unexposed groupD. Use of estrogen is not associated with breast cancer