One common secondary structure found in proteins in the a-helix. On the diagram below is an a- helical region of the enzyme lysozyme. The sequence of this region is: NHArg - Cys - Glu - Leu - Ala - Ala - Ala - Met-Lys... COO- 0 on the top 0 on the bottom R 0 0 Is the N-terminus on the top or on the bottom of this diagram? R

One common secondary structure found in proteins in the a-helix. On the diagram below is an a- helical region of the enzyme lysozyme. The sequence of this region is: NHArg - Cys - Glu - Leu - Ala - Ala - Ala - Met-Lys... COO- 0 on the top 0 on the bottom R 0 0 Is the N-terminus on the top or on the bottom of this diagram? R

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Similar questions

Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH₂OH HO OH Н H CH₂OH Н ОН HO HN-C-CH3 о c=0 NHI -NH-C - CH2C-H ОН Н нн ОН НН CH2OH Он OH HO Н NH 1 С=0 -CH2-C-н NH C=0 LO-CH2-C-H NH A В с
AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remain
otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit
The diagram to the right illustrates the inter-actions of the amino acid side chains of two a-helical polypeptide strands in a coiled-coil, viewed end-on and projected along the helix axes from the N-terminal to the C-terminal end. Are the macrodipoles of the two a- helices oriented parallel or anti-parallel? For this projec- tion is the positive end of the macro-dipole in the sur- face of the paper or below the surface? f C b g e d a' a d' g b' f'
Changing one amino acid within a protein sequence from a tryptophan to a stop codon would be best classified as Amino acids groups Group Characteristics Names Ala, Val, Leu, Ile, Pro, Phe Trp, Met Ala: A Leu: L non-polar hydrophobic Arg: R Asn: N Lys: K Met: M Asp: D Cys: C Gly: G polar hydrophilic (non-charged) Gly , Ser, Thr, Cys, Tyr, Asn Gln Phe: F Pro: P Ser: S acidic negatively charged Asp, Glu Glu: E Gln: Q Thr: T His: H lle: I Trp: W Туr: Y Val: V basic positively charged Lys, Arg, His A) Conservative missense O B) Nonsense O C) Neutral O D) Non-conservative missense
5′ - A U G C A A U A C A A U C C G G A A U G A - 3′ Give the primary structure of the protein that the ribosome will build, by writing the 3-letter codes of the amino acid residues in the usual order N- to C-terminus. If there is mor
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
Determining the amino acid sequence in a protein usually in- volves treating the protein with various reagents that break up the protein into smaller fragments that can be individually sequenced. Treating a particular 11-amino acid polypeptide with one reagent produced the fragments: Ala-Leu-Phe-Gly-Asn-Lys Trp-Glu-Cys Gly-Arg Treating the same polypeptide with a different reagent pro- duced the fragments: Glu-Cys Gly-Asn-Lys-Trp Gly-Arg-Ala-Leu-Phe What is the amino acid sequence of the polypeptide?
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What is the N-terminus? 2.What is the C-terminus?
tRNA True or false A given tRNA can be charged with only one particular amino acid The anticodon of tRNA finds the complementary codon on mRNA The amino acid is attached to end of tRNA The amino acid is recognized by the anticodon of tRNA