Q: Describe the major evolutionary advancements that took place among the australapiths and the early…
A: I hope these suggestions and recommendations help you with your assigned tasks. To further…
Q: Describe how the RTS threshold works
A: The RTS (Request to Send) threshold is a parameter used in wireless networking, particularly in…
Q: Please answer all the question . This is Anthro work. Someone please do it now
A: Question 6:Of the choices you provided, a fracture is the most likely pathology indicated on the…
Q: Anne had the smallpox virus. She is unlikely to get sick if she is infected with the smallpox virus…
A: The question is asking whether Anne, who has previously been infected with the smallpox virus and…
Q: I need help please can you red through the links (3) and find somthing very intresting to someone…
A: Interesting Facts about Oropharyngeal Cancer:Link 1:…
Q: Question 14 Why are long reads the preferred method to sequence repetitive elements? Select the…
A: "If a repetitive region is longer than 300 basepairs (the length of a short read), it's impossible…
Q: 9. What does a person with Alzheimer’s disease have difficulty within the early stage? Changing…
A: Answer well explained above
Q: Meiosis:
A: MEIOSISBEFORE MEIOSISInterphaseDNA is replicatedMEIOSIS IProphase ISynapses occurs; crossing over…
Q: Match the following terms with the best description. Question 6 options: A…
A: The objective of the question is to match the given terms with their correct descriptions.
Q: hello what 5 +5
A: The given question is what is 5+5So, we will use the BODMAS rule for adding the two numbers…
Q: Flowering plants (angiosperms) Conifers, cycads, Ginkgo gnetophytes (gymnosperms) Ferns & horsetails…
A: A paraphyletic group includes the common ancestor and some, but not all, of the ancestor's…
Q: Biological Macromolecules Understanding that DNA replication is semiconservative -pil... 0/5…
A: In Experiment #1, the first replication round involves the incorporation of radioactive adenine into…
Q: 5. What tip should be used when assisting a person with Alzheimer’s disease with eating? Know the…
A: Detailed explanation:When aiding people with Alzheimer's disease during mealtimes, it is critical to…
Q: 10. How can you promote independence while the person is taking a bath? Ask the family to help.…
A: Approach to solving the question: Select the best option Detailed explanation: Encouraging the…
Q: Urgently needed
A: A) In conditions of low tryptophan abundance, the trp operon will not be repressed by the trp…
Q: During a routine exam, Jessica has some blood taken and analyzed. The results show a high IgM titer…
A: IgM and IgG Antibodies:The body produces antibodies to start an immune response in response to…
Q: Why did bipedalism evolve? What were the advantages of our early ancestors becoming bipedal?
A: The evolution of bipedalism, the ability to walk on two legs, is one of the defining characteristics…
Q: A paleontologist finds a hominid fossil skull in a stratum dated at 4.4 MYA in eastern Africa. The…
A: Detailed explanation:The most likely candidate for the hominid fossil skull is: Ardipithecus…
Q: What enabled modern humans to colonize the world? Explain what Dan Lieberman means by "Brains and…
A: Approach to solving the question: I hope I was able to help you in elaborating on the topic. feel…
Q: One example of innovation from an unexpected source came from the study of tumor-like plant growths…
A: The correct answer is:- The ability of Agrobacterium tumefaciens to integrate its genes into the…
Q: make sure it’s correct i need asap
A: Detailed explanation:Of course! For a more thorough explanation, see this:Range Expansion: As a…
Q: Case 1: In late August, a woman brought her 11 year old son, Michael, to their family physician…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: There is only one correct way to perform antibody identification Question 4 options:…
A: The objective of the question is to determine whether there is only one correct method to perform…
Q: 6. What is the key to ADL success? Negative body language Doing the task for the person…
A: Preparation:Preparation is undoubtedly the cornerstone of success in activities of daily living…
Q: In cattle, a mixed coat color occurs in the heterozygous offspring of red (RR) and white (rr)…
A: Answer well explained above
Q: How do oxygen minimum zones (OMZs) which are subject to constantly low concentrations of oxygen,…
A: The development of Oxygen Minimum Zones (OMZs) is a complex process that involves both biological…
Q: The following image is a scheme for serial dilutions prepared for spectrophotometric analysis. If…
A: Step 1:Step 2:Step 3:Step 4:Step 5:
Q: Meme More Details Emailed on Thurs (120 min limit)--ONLY OPEN WHEN ... FRAME WILSON 363 0:54:24…
A: During the COVID-19 pandemic, particularly in areas like Louisiana where there may be limited…
Q: What are the subsectors of the fisheries and aquaculture sector? Select two or more:…
A: The question is asking to identify the subsectors of the fisheries and aquaculture sector. The…
Q: What were Mousterian Industry tools used for?
A: The objective of the question is to understand the purpose and usage of the tools that were…
Q: Experiment A microarray was hybridized with a mixture of two differentially labeled fluorescent…
A: I based my response on the experimental setup described in the prompt. In the experiment, two…
Q: Can someone explain explain how the silent and missense mutations are different from each other? I…
A: Frameshift mutations and nonsense mutations are two forms of genetic mutations that can cause…
Q: Post-anal tail is a unique feature shared by invertabrates and jawless fish chordates tetrapods all…
A: The objective of the question is to identify the group of organisms that share the unique feature of…
Q: What did Darwin observe regarding finches on different islands in the Galapagos? Different beak…
A: Choice B Explanation:Darwin noted that the various beak forms and sizes of finches on the various…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of this question is to create a pathophysiology flow chart for an Upper Respiratory…
Q: Blood and blood vessels would be the highways. Highways and roads connect all parts of the city to…
A: Blood vessels are pathways that transport blood throughout the body. They form a closed loop,…
Q: If provided with a DNA sequence, you should be able to identify where transcription will start;…
A: Answer well explained above.
Q: How do we reduce the use of pesticides in farming?
A: The objective of the question is to understand the various methods that can be employed to reduce…
Q: what is the simplest way to solve this? please give me a step by step explanation.
A: To find the difference in order of magnitude between the sizes of the megakaryocyte and the…
Q: What is/are the possible genotype(s) of an individual who is lactose tolerant?
A: The objective of the question is to determine the possible genotypes of an individual who is lactose…
Q: The phylogentic tree below depicts the evolutionary relationships of the following species A through…
A: Evolutionary time is not important in determining the relationship between the species in a…
Q: Describe the progression of cancer from an early benign lesion to a genetically heterogeneous…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: What is/are the possible genotype(s) of an individual who is lactose intolerant?
A: The objective of this question is to identify the possible genotypes of an individual who is lactose…
Q: What is the simplest way to solve this? Please give me a step by step explanation.
A: Approach to solving the question:Detailed explanation: Note: 10×10−2=101−2=10−1…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of this question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: Identify the three individuals whose investigations led to the banning of the use of…
A: I have provided the answer above for you. See the answer I provided above to understand the given…
Q: A ALEKS - Julianna Graham - Lex ← -> +…
A: To predict the percentage of DNA that is radioactive after each experiment, we need to understand…
Q: THINK ABOUT IT- Look at the food web below and answer the questions. FIGURE 6.3 Food webs: (a) a…
A: Food webs show intricate relationships that sustain life within various ecosystems, showcasing the…
Q: Based on the information provided by the Angus pedigree below, Princess Alta of Wey (R) is inbred. T…
A: Inbreeding occurs when an animal's parents are more related than the average individual in the…
Q: What aspects of biotechnology do you think hold the most potential for controlling parasitic…
A: Controlling parasitic diseases is a significant global health challenge that impacts millions of…
Genetics Q1
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Question 46 Cellular transcription is : O Use of DNA as a template to make complementary DNA Use of DNA as a template to make complementary RNA O Use of RNA as a template to make proteinsQuestion 17 What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3 A 5'-UAGUGACAGUUGCGAU-3' B 5-TAGCGTTGACAGTGATA-3 5'-ATCACTGTCAACGCTA-3 D 5'-TAGTGACAGTTGCGAT-3'Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger electropherogram of a sequence from a patient without sickle cell and one with sickle cell. Sequence from a normal individual mmmm Sequence from the diseased individual G T GIIC A GC A Se SCIENCEphe A G A SCIENCE SCIENCEphoto G a) Where is the change in the sequence and what is the consequence to the protein sequence of this mutation? b) Below is an image of the normal and diseased quaternary hemoglobin protein. What is different about the protein shape and why does that structure have a huge impact on its function (please name the function!)? Adult haemogBRAR G G G G A G Sickle Cell haemoglobin S Structure a s RARY COLIBRARY c) If you were to use CRISPR to modify the genome of a diseased individual, to which nucleotides might you design your guide RNA? Why? d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool to determine these effects? e) Data on…
- Question 7 (2 points) Determine the matching base pairs that RNA polymerase would lay down for this DNA sequence: TGCAGACT *record your answer with no spaces, dashes, or other charactersQuestion 43 The DNA strand that serves as a template during transcription is known (other than "template") as the or noncoding strand. Blank 1 Blank 1 Add your answerQuestion 19 A transversion mutation would be replacing T by: A either A or G BU (c) T D) c
- QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.Question 47 (a) Use the following figure to determine the changes to the amino acids that correspond to the normal and mutated DNA sequences. Normal DNA sequence: 3 CAT TCA AAC ATT 5 Mutated DNA sequence: 3 CAT AGT GAG GTC 5 (Hint: Write the mRNA first, then identify the amino acids.) (b) What type of mutation is shown? First base of codon U C A G U UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA Met ACG GCU GCC GCA GCG Phe -Leu Leu lle Second base of codon A C Val -Ser Pro Thr Ala UAUTYT туг UAC UAA UAG CAU CAC CAA CAG. His Gin AAU AAC Asn AAA GAUT GAC GAA GAG Asp G AAGLYS AGG. GGU GGC GGA GGG Glu UGU UGC UGA UGG CGU CGC CGA CGG Bys A Trp G U C -Arg AGU AGC AGA аса за Ser Arg U C Gly AG A U C A G U C A G Third base of codonQuestion 33 What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 O 3- GCCTACGGGCATATG -5 O 5- GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG -3 O 3- CGGATGCCCGTATAC -5
- Question 34 Which is the DNA template given if the MRNA is 5- CGGAUGCCCGUAUACGUA -3? о з- GССТАСGGGCATATGGTA -5 O 5- GCCTACGGGCATAAGGAT -3 0 5- GCCTACGGGCATATGCАТ-3 о 3- CGGATGCCCGTATACCТА -5Quèstion 34 Enzyme that joins the DNA fragments O Recombinant DNA Technology O Restriction enzymes O Ligase O Palindromic sequencesQUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT