Question 2 Listen Tina Is the mother of Violet, Jose, Kelly and Paul. Ramone is a potential father. You are trying to determine which if any children could be the offspring of Ramone Tina Ramone Violet Jose Kelly Paul Gene 1 Gene 2 You analyze 2 genes Gene 1 and Gene 2 known to have variable numbers of repeats. After PCR and gel electrophoresis, you get the results shown above. Based on these results you conclude that Jose a) Must be the offspring of Ramone and and Tina b) Can not be the offspring of Ramone and Tina c) Could be the offspring of Ramone and Tina
Q: You are interested in seeing where the two proteins are located in the cells. You order antibodies…
A: Here's a procedure to investigate protein localization in cells using antibodies: Title: Protein…
Q: According to Stephen Hales, if systolic blood pressure in the brachial artery (SBP) = 150 mm Hg, and…
A: The objective of the question is to calculate the mean arterial pressure (MAP) given the systolic…
Q: Urgently needed
A: To answer your questions, we first need to determine the Open Reading Frame (ORF) from the provided…
Q: Lucy, a 30 year old opioid addict is taken to hospital and is believed to be suffering from MPTP…
A: MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) poisoning is a serious illness that can result…
Q: See image
A: The objective of the question is to calculate the weight of one Aminophylline-loaded suppository.…
Q: what does it mean if a ratio is 1.5
A: A ratio is a way of comparing two or more quantities. It is a mathematical expression that…
Q: You are studying a new inhibitor that you know prevents proper formation of ribosomes by binding to,…
A: Let's break down the explanation further and provide an example to illustrate the concept: RNA…
Q: The Centers for Disease Control and Prevention (CDC) program PulseNet uses genomic fragments that…
A: Pulsenet uses highly multiplexed amplicon sequencing (HMAs) panels for surveillance subtyping. It…
Q: How can I solve this equation?
A: Given, Every time the bacteria reproduce, the number doubles. Which means, it represents an…
Q: What is reproductive cloning? How is it done? (Hint: review the discussion on crispr)
A: Reproductive cloning is a method used to make a clone or an identical copy of an entire…
Q: Describe how the RTS threshold works
A: The RTS (Request to Send) threshold is a parameter used in wireless networking, particularly in…
Q: Please explain this. Below is the payoff matrix for a two-player-two-move game. If…
A: ConceptThe Prisoner's Dilemma in game theory is where two rational individuals might not cooperate,…
Q: Q005) Using your worksheet above, determine the sex for cranium 1B: Male 1.Describe two cranial…
A: Approach to solving the question: Detailed explanation:Overall Cranial Size and Shape: Male skulls…
Q: Using your worksheet above, determine the sex for pelvis 2A: female 1.Describe two pelvic sexing…
A: PLEASE SEE HERE;Here is the guided explanation; you can tailor it and add your own insights. The…
Q: +…
A: To determine the base sequences for a silent mutation and a non-silent (or missense) mutation in the…
Q: Lactic acid is a biproduct formed at the end of anaerobic respiration. This molecule is dangerous to…
A: Approach to solving the question: I hope this helps! Detailed explanation: Examples: Key references:
Q: 18. (07.07 HC) Due to its location, Hawaii does not have very many land birds. The Hawaiian…
A:
Q: Smallpox is the only infectious disease eradicated because so many people were vaccinated worldwide.…
A: The objective of the question is to understand why, despite having effective vaccines, we have not…
Q: make sure it’s correct
A: The sex of turtles is dependent on or determined by the temperature in such a way that warm eggs…
Q: For the following first-order liquid-phase reversible reaction, where initially only reactant A is…
A: Step 1:Given data :A ⇌ R Where, k1 is rate constant for forward reaction & k2 is rate constant…
Q: In cats, there is a coat color gene located on the X chromosome which has two alleles—an allele for…
A: Answer well explained above.
Q: Which is NOT a primate trait: A) Convergent eyes B) Nails instead of claws C) Post orbital bar D)…
A: The question is asking us to identify which of the given options is not a characteristic trait of…
Q: 3. What level of assistance will you most likely have to provide for a person in the late stage of…
A: Why B. Total Assistance is the Most Likely Answer:Late-Stage Alzheimer's Impact: In the later stages…
Q: Question 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune…
A: Detailed explanation: Option 1 is CORRECT because the natural function of the bacteria's CRISPR-Cas…
Q: The Reverse Transcriptase and Integrase enzymes produced by Retrotransposons sometimes mistakenly…
A: In general, the transposed element that results from a retrotransposon interacting on a cellular…
Q: You have 3 populations inhabiting the same landmass. Individuals from the first and second…
A: The biological species concept defines a species as a group of interbreeding individuals that are…
Q: Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY…
A: 1DNA:CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATCmRNA:--- --- AUG…
Q: Who determines the professional standard of care in negligence lawsuits? Question 10 options:…
A: The question is asking who is responsible for determining the professional standard of care in…
Q: Case 1: In late August, a woman brought her 11 year old son, Michael, to their family physician…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: What is a lactose-tolerant male's genotype? A lactose intolerant female's?
A: Important information:Lactase persistence (the ability to digest lactose into adulthood) is…
Q: 4. Analysts believe that Manufactured Earnings is a "darling" of Wall Street analysts. Its current…
A: Let's dissect the computation in detail. The Gordon Growth Model can be used to predict the market's…
Q: In the case of Per3, there is a 54-base pair sequence that is repeated 4 times in one allele, and 5…
A: Research on the Per3 gene, which includes a variable number repeat of a 54-base pair (bp) sequence,…
Q: ) The largest animal virus is classified as: a) Herpesvirus b) Poxvirus c) HIV d) Flu virus e)…
A: The objective of the question is to identify the largest animal virus among the given options:…
Q: Although the virus that causes smallpox has been eradicated, there are still stocks of the virus,…
A: The objective of the question is to understand the reasons why someone might argue for the…
Q: Evaluating the positive and negative effects stress has on the body 1. Can stress be addictive
A: Chronic stress can lead to changes in the brain's structure and function, particularly in areas…
Q: Tarsiers have been reclassified into which suborder of primates: A) strepirrhini B) Lemurs C)…
A: The question is asking to identify the suborder of primates into which Tarsiers have been…
Q: Below is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence…
A: The objective of the question is to transcribe and translate the given DNA sequences for normal and…
Q: Exame and describe the notable characteristics of the casts of Ardipithecus' hand and foot. What do…
A: The question is asking us to analyze and describe the significant features of the hand and foot…
Q: Biomedical Engineering: An equilibrium dialysis experiment was performed to characterize the binding…
A: Association constant of :Mouse Ig G = 4.75 × 108 M-1Human Ig G = 1.3 × 1010 M-1 a) Dissociation…
Q: make sure it’s correct i need asap
A: Step 1:Step 2:Step 3:Step 4:
Q: Regarding optic ataxia, what is its clinical etiology, symptoms, and treatments. What are the…
A: Etiology (Causes)Brain Regions Involved:• Parietal Lobe: This region integrates visual and motor…
Q: 1. Four genes (A,B,C,D) of a bacterium code for four enzymes (A,B,C,D), which act sequentially to…
A: Approach to solving the question:. Detailed explanation: Examples: Key references:
Q: 7. What level of assistance will you most likely have to provide for a person in the late stage of…
A: I chose "total assistance" as the answer and not the other options provided because in the late…
Q: Discuss and conclude the results given for the effects of exercise on breathing and heart rate.
A: The effects of exercise on breathing and heart rate in more detail:Breathing: During exercise, our…
Q: You are studying a protein-protein interaction in 2 proteins. You decide to test both these proteins…
A: Detailed explanation:Okay, let's explore this more: a. Type of Protein-Protein Interaction:Based on…
Q: A ALEKS - Julianna Graham - Lex ← -> +…
A: To predict the percentage of DNA that is radioactive after each experiment, we need to understand…
Q: 2. What is the best way to approach toileting with persons with Alzheimer’s disease? Upon request…
A: Proactive:Observe their routine: Look for signs they might need to use the restroom, like…
Q: Over the long period of time that life has existed on Earth, there have been a number of important…
A: The innovation of endosymbiosis, which involved the integration of ancestral prokaryotic cells into…
Q: Marasmus is associated with ____. a. changes in skin and hair pigmentation b.…
A: The question is asking to identify the symptom that is associated with Marasmus, a severe form of…
Q: Considering a One Health approach, what do you think is the biggest challenge facing the future of…
A: Certainly, I'll expand on the key challenges facing parasitology from a One Health perspective:1.…
GQ2
Step by step
Solved in 2 steps with 1 images
- QUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes specifically recognize and cut short sequences of DNA called introns. O exons. O sticky ends. restriction sites. QUESTION 9 The DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows O the order of genes along particular chromosomes O the order of bases in a particular gene O the presence of differently-sized fragments of DNA O the presence of dominant or recessive alleles for particular traits O the number of chromosomes and whether any are damagedQuestion 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.| Choose J [Choose] repetitive DNA transposable elements transposon retrotransposon pseudogenes
- b) Among the progeny from the Hfr3 mating above, you find one that has the genotype: Abc de F Draw out the gene transfer and crossover(s) that produced this outcome: c) Among the progeny from the Hfr3 mating above, you find one that has the genotype: A B c d e f Draw out the gene transfer and crossover(s) that produced this outcome:Question 5 Review DNA sequencing and cloning tools. Which of these is not used to make a recombinant DNA? O restriction enzymes to create sticky ends of a plasmid O fragment from a different DNA cut by the same restriction enzyme O DNA ligase seals the recombinant DNA O denaturationQuestion 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…
- QUESTION 6 Place the Polymerase Chain Reaction events listed below in the order in which they occur. Double-stranded DNA is produced DNA sample is heated Test tube with DNA sample is placed in machine Taq polymerase initiates DNA synthesis DNA denaturesQUESTION 49 You have discovered a very small amount of DNA from an ancient organism that you want to save and study. What is the very first thing you should do to allow you to study this DNA in the lab? O a. Insert the DNA into a vector Ob.RT-PCR Oc. Gel electrophoresis. O d.PCR Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers Save and Submit ScieUsing the designed forward and reverse primer from Question 23-30, you performed PCR to amplify the CO1 gene of S. tawilis. Then, you verified the PCR product using the Agarose Gel Electrophoresis. Here is the result of the AGE. M-Marker L1-PCR Product ML1 You noticed that there are many bands in your PCR product. What does this indicate? Choose the best answer. The primers were not specific to CO1 gene. The annealing temperature is too high. The templated DNA is not enough. There is a formation of primer dimers. The primer length is too short. The melting temperature is too high.
- QUESTION 2 Variable expression of the MERRF syndrome arises from recombination between nuclear and mtDNA O homoplasmic cells mitotic segregation nuclear genes environmental factorsQUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…