Question 2 Listen Tina Is the mother of Violet, Jose, Kelly and Paul. Ramone is a potential father. You are trying to determine which if any children could be the offspring of Ramone Tina Ramone Violet Jose Kelly Paul Gene 1 Gene 2 You analyze 2 genes Gene 1 and Gene 2 known to have variable numbers of repeats. After PCR and gel electrophoresis, you get the results shown above. Based on these results you conclude that Jose a) Must be the offspring of Ramone and and Tina b) Can not be the offspring of Ramone and Tina c) Could be the offspring of Ramone and Tina
Q: What are the subsectors of the fisheries and aquaculture sector? Select two or more:…
A: The question is asking to identify the subsectors of the fisheries and aquaculture sector. The…
Q: Post-anal tail is a unique feature shared by invertabrates and jawless fish chordates tetrapods all…
A: The objective of the question is to identify the group of organisms that share the unique feature of…
Q: Humans have a complex relationship with fresh water and having too much or too little can be deadly.…
A: The objective of the question is to understand how human populations respond to extreme water…
Q: You are studying a new inhibitor that you know prevents proper formation of ribosomes by binding to,…
A: Let's break down the explanation further and provide an example to illustrate the concept: RNA…
Q: The reaction of a carcinogen with genomonic DNA will most likely result in DNA damage that cannot be…
A: When a cancer-causing substance (carcinogen) comes into contact with the genomic DNA, it may cause…
Q: A child with Type O blood is born to a mother with Type B blood. What is the genotype of the child?…
A: The child has type O blood because they inherit two "O" genes, one from each parent. The mother has…
Q: What types of early adaptation measures should be prioritized in national adaptation plans or…
A: The objective of the question is to identify the types of early adaptation measures that should be…
Q: When Galileo Galilei rolled a ball down an inclined plane, it traveled 2 meters in the first second,…
A: Approach to solving the question:Please see attached photos for detailed solutionsDetailed…
Q: The following image is a scheme for serial dilutions prepared for spectrophotometric analysis. If…
A: Step 1:Step 2:Step 3:Step 4:Step 5:
Q: write the importance of plant-associated microbiome in plant health and growth of…
A: The plant-associated microbiome plays a crucial role in plant health and growth. These…
Q: Do you think the current conversation about abortion makes good arguments? If so, what is…
A: I hope these suggestions and recommendations help you with your assigned tasks. Have a great day…
Q: A paleontologist finds a hominid fossil skull in a stratum dated at 4.4 MYA in eastern Africa. The…
A: Detailed explanation:The most likely candidate for the hominid fossil skull is: Ardipithecus…
Q: Neanderthals lived in caves. True or false
A: The question is asking whether Neanderthals, an extinct species of human that lived about 40,000…
Q: Joseph Black (Royal Society of Edinburgh) found that heating magnesium carbonate produces:…
A: The objective of the question is to identify the product formed when magnesium carbonate is heated,…
Q: 2. What is the best way to approach toileting with persons with Alzheimer’s disease? Upon request…
A: Proactive:Observe their routine: Look for signs they might need to use the restroom, like…
Q: What is the simplest way to solve this? Please give me a step by step explanation.
A: To solve this problem, you need to convert the given measurement from meters to micrometers.Here's a…
Q: Are humans still evolving? Use an example from BBC's "How human culture influences our genetics."
A: Yes, humans are still evolving, and cultural practices can influence the direction and pace of human…
Q: Biological Macromolecules Understanding that DNA replication is semiconservative -pil... 0/5…
A: In Experiment #1, the first replication round involves the incorporation of radioactive adenine into…
Q: See image below
A: The objective of the question is to calculate the total weight of the compounded capsule product,…
Q: Can someone explain explain how the silent and missense mutations are different from each other? I…
A: Frameshift mutations and nonsense mutations are two forms of genetic mutations that can cause…
Q: Choose a theory or concept involving biomechanics and discuss how you can apply it when having a job…
A: Biomechanical Principles in Physical Therapy: Enhancing Patient OutcomesAs a physical therapist, the…
Q: What enabled modern humans to colonize the world? Explain what Dan Lieberman means by "Brains and…
A: Approach to solving the question: I hope I was able to help you in elaborating on the topic. feel…
Q: How many species of penguins are endemic (can be found only in 1 location)? _______ In more than 1…
A: Answer well explained above
Q: Case 1: In late August, a woman brought her 11 year old son, Michael, to their family physician…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: 13 Match each of the QPCR samples (i-v) with the correct amplification plot (A-E) and determine the…
A: Quantitative polymerase chain reaction (qPCR) is a widely used molecular biology technique for…
Q: A sexually reproducing organism has the following phenotype DdEeAaTt: The D and E loci are on the…
A: The objective of the question is to illustrate the metaphase of mitosis for a sexually reproducing…
Q: Strepsirrhines differ from haplorrhines in retaining more ancestral traits from the earliest…
A: The question is asking whether Strepsirrhines, a suborder of primates, retain more ancestral traits…
Q: based on the image answer the following question 1. what is the gene order 2. what are the map…
A: Determine the gene order: In interrupted mating studies, the order of genes is determined by…
Q: Experiment A microarray was hybridized with a mixture of two differentially labeled fluorescent…
A: I based my response on the experimental setup described in the prompt. In the experiment, two…
Q: Draw the peptide Glycine-Alanine-Serine-Cysteine-Isoleucine-Glutamic acid Tryptophan-Valine. Circle…
A: To explain in more detail, let's delve deeper into the structure and bonding of the peptide…
Q: Forensics Q3
A: 1. **Offspring who cannot be the offspring of Tom (assuming a typo in the provided data corrected…
Q: An angiosperm which is unable to form fruits would likely have which of the following defects?…
A: The question is asking about the potential defects that an angiosperm, or flowering plant, would…
Q: About adaptation planning, which of the following sentences are true? Select two or more: An…
A: The objective of the question is to identify the correct statements about adaptation planning from…
Q: 1. scapula tarsals sternum lumbar vertebra humerus innominate skull (cranium and mandible)…
A: Here is a further explanation of my answers above: The skeletal remains you presented consist of a…
Q: 1. Which of these statements about workplace bullying is correct? The term is another way of…
A: The problem of bullying in the workplace is widespread and has the potential to have negative…
Q: True or false: Vertebrates are taxonomically more diverse than invertebrates
A: 1. Understanding Taxonomy: - Taxonomy is the science of classifying organisms into different groups…
Q: One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is…
A: To determine the size of the CACNA1S transcript named CACNA1S-202 in terms of amino acid residues,…
Q: Question 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune…
A: Detailed explanation: Option 1 is CORRECT because the natural function of the bacteria's CRISPR-Cas…
Q: i need help woth these questions
A: Checkpoint pathways are essential mechanisms that ensure the orderly progression of the cell cycle…
Q: A ALEKS - Julianna Graham - Lex ← -> C +…
A: The complete mutated DNA sequences for both types of mutations (silent and non-silent) from the…
Q: Evaluating the positive and negative effects stress has on the body 1. Does stress affect out…
A: Approach to solving the question: To address the question of how stress affects our ability to…
Q: Apes evolved from New World Monkeys. True or false?
A: The question is asking whether apes, a group of primates, evolved from New World Monkeys, another…
Q: how is the heridetary material organised in the nucleus and the chromosomes
A: The hereditary material in a cell is organized in the nucleus, which is a membrane-bound organelle…
Q: having extra digits is a dominant trait. a man has extra digits while his wife and their daughter…
A: 1. **Genotypes of the Parents**: - The man has extra digits, so he must have at least one dominant…
Q: State the percentage range of the fresh weight of animals that is made up of water, and situate…
A: The objective of the question is to understand the percentage of water that makes up the fresh…
Q: Q 7: What is the function of the nuchal crest? Which species have a pronounced one and what does…
A: Approach to solving the question: Comprehensive analysis provided as per the topic mentioned in the…
Q: Pierre Simon de Laplace claimed that all of the following planets in our solar system are older than…
A: Pierre-Simon Laplace, was a renowned French mathematician as well as astronomer He made important…
Q: ory X Gakg614 micro x Mail - Kayli Je X Google Docs × <for X Xavier Univer x…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: What is a lactose-tolerant male's genotype? A lactose intolerant female's?
A: Important information:Lactase persistence (the ability to digest lactose into adulthood) is…
Q: Describe how the RTS threshold works
A: The RTS (Request to Send) threshold is a parameter used in wireless networking, particularly in…
Genetics Question 2
Step by step
Solved in 2 steps
- QUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes specifically recognize and cut short sequences of DNA called introns. O exons. O sticky ends. restriction sites. QUESTION 9 The DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows O the order of genes along particular chromosomes O the order of bases in a particular gene O the presence of differently-sized fragments of DNA O the presence of dominant or recessive alleles for particular traits O the number of chromosomes and whether any are damagedQuestion 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.b) Among the progeny from the Hfr3 mating above, you find one that has the genotype: Abc de F Draw out the gene transfer and crossover(s) that produced this outcome: c) Among the progeny from the Hfr3 mating above, you find one that has the genotype: A B c d e f Draw out the gene transfer and crossover(s) that produced this outcome:
- | Choose J [Choose] repetitive DNA transposable elements transposon retrotransposon pseudogenesJoe is heterozygous for a dominant genetic disease. His wife, Jenny does not have the disease. They have 5 children of which 2 (Jim and Jan) have the disease and 3 (Jose, Jerry and Julie) do not. DNA from each individual is isolated and analyzed by PCR an gel electrophoresis. 3 variable markers are studied. The results for each marker are shown here. The numbers to the left of each gel represent size in hundreds of bases Jim Jose Marker 1 Marker 2 Marker 1 Jenny Joe Marker 3 Jan Jerry Julie Jim Jose Marker 2 Jenny Joe Jan Jerry Julie Jim Jose Marker 3 Jenny Joe Based on these results, which marker is most likely associated with the condition? Jan Jerry JulieQUESTION 49 You have discovered a very small amount of DNA from an ancient organism that you want to save and study. What is the very first thing you should do to allow you to study this DNA in the lab? O a. Insert the DNA into a vector Ob.RT-PCR Oc. Gel electrophoresis. O d.PCR Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers Save and Submit Scie
- Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…QUESTION 6 Place the Polymerase Chain Reaction events listed below in the order in which they occur. Double-stranded DNA is produced DNA sample is heated Test tube with DNA sample is placed in machine Taq polymerase initiates DNA synthesis DNA denaturesUsing the designed forward and reverse primer from Question 23-30, you performed PCR to amplify the CO1 gene of S. tawilis. Then, you verified the PCR product using the Agarose Gel Electrophoresis. Here is the result of the AGE. M-Marker L1-PCR Product ML1 You noticed that there are many bands in your PCR product. What does this indicate? Choose the best answer. The primers were not specific to CO1 gene. The annealing temperature is too high. The templated DNA is not enough. There is a formation of primer dimers. The primer length is too short. The melting temperature is too high.
- QUESTION 2 Variable expression of the MERRF syndrome arises from recombination between nuclear and mtDNA O homoplasmic cells mitotic segregation nuclear genes environmental factorsQUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…