QUESTION 8 Check all the statements that are TRUE regarding 16S or ITS (microbiome) illumina (NGS) sequencing vs. whole genome illumina (NGS) sequencing. O A. You don't need to trim the reads for 16S sequencing, but you do for whole genome sequencing. O B. Whole genome sequencing files will have more reads in them because genomes are bigger than 16S amplicons. OC. The read alignment and contig assembly steps would probably be harder for whole genome sequencing. O D. The 165 molecules being sequenced are always DNA, while for whole genome sequencing they could be RNA or DNA going into the illumina sequencer. O E. NGS for 16S and whole genome sequencing can both use sample indexes/barcodes to maximize efficiency. O F. Whole genome sequencing doesn't necessarily require you to know any of the sequences/targets before hand to design specific primers for.

QUESTION 8 Check all the statements that are TRUE regarding 16S or ITS (microbiome) illumina (NGS) sequencing vs. whole genome illumina (NGS) sequencing. O A. You don't need to trim the reads for 16S sequencing, but you do for whole genome sequencing. O B. Whole genome sequencing files will have more reads in them because genomes are bigger than 16S amplicons. OC. The read alignment and contig assembly steps would probably be harder for whole genome sequencing. O D. The 165 molecules being sequenced are always DNA, while for whole genome sequencing they could be RNA or DNA going into the illumina sequencer. O E. NGS for 16S and whole genome sequencing can both use sample indexes/barcodes to maximize efficiency. O F. Whole genome sequencing doesn't necessarily require you to know any of the sequences/targets before hand to design specific primers for.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 14QP

See similar textbooks

Similar questions

Question 4. Given the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' and the GC content is 60%, c) Which of the following will lead to DNA cutting more frequently? Choose all that apply. O Increasing the AT content to 60% O Using a seven base cutter with the sequence 5'-GGATCCC-3' O Using a five base cutter with the sequence 5'-GGACC-3' O Increasing the GC content to 70% O Decreasing the GC content to 50%
Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' ? b) Assuming that the % GC is = 60%. O (2/10)4 (3/10)² O (3/10)4 (2/10)² O (1/6)4 O (1/4)6 O (6/10)4 (4/10)2
Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3'? a) Assuming that the four bases are equally likely to be found in a DNA molecule. O (1/4)6 O (1/4)4 O (1/6)4 O 1 in 6 O (1/6)6
Question 14 Why are long reads the preferred method to sequence repetitive elements? Select the statement that is FALSE. ◇ If a repetitive region is longer than 300 basepairs (the length of a short read) it's impossible to determine the total length. O Long reads are more likely to span repetitive regions on either side, making it easier to map the repetitive regions. O It's hard to determine where short reads should be placed, as they could map to multiple repetitive regions. O Long reads are less error prone and thus better for sequencing overall. Question 15 Which of the following statements is NOT true about GWAS? When identifying alleles associated with a disease, we compare the frequency of an allele in a control group versus a cash group
QUESTION 14 What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence immediately downstream of your target site. What happens? O It's fine because you put the PAM sequence in your guide RNA O PAM sequences only apply to real viral infections, not CRISPR assays. O The Cas9 nuclease won't cut at the target site O The guide RNA won't be complementary to the target O They'll be more off target effects but it'll still work.
| Choose ) [ Choose] metagenomics whole-genome shotgun approach bioinformatics ed GenBank genomics
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start site
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with protein
QUESTION 32 Molecular recording involves... O Harvard University A novel way to store large amounts of data OEncoding information into living cells The CRISPR-Cas system All of the abovel
Question:- When large genomes are sequenced, which of the following is true? Group of answer choices The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced. The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome. Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used. The assembled sequences must have all gaps closed if the genome is to be useful for the research community.
Question 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.