Question 9 Listen C. elegans, a tiny worm has about as many genes as humans, but makes far fewer types of proteins. This is likely due to the fact that: a) There is more transcriptional regulation in humans than in worms b) Humans and worms have a different genetic code c) There is more alternate splicing in humans than in worms
Q: Please provide explanation for each step
A: The objective of the question is to identify the DNA sequence that is palindromic when…
Q: Describe the unique features of muscle fibers that allow them to contract.
A: The unique features of muscle fibers that allow them to contract are primarily due to their…
Q: QUESTION 2 Axolotls are unusual looking amphibians that reach adulthood without undergoing…
A: The Hardy–Weinberg principle, asserts that, in the lack of further evolutionary factors, genotype…
Q: What is the substrate concentration at the beginning of the reaction in mM ?
A: An enzyme kinetic experiment is a scientific investigation that studies the rate of enzymatic…
Q: Match the following solutions to examples that address problems for biodiversity. Habitat…
A: All these conservation programs are planned to conserve the existing biodiversity and promote…
Q: Write a set of directions for a red blood cell to deliver oxygen to the brain. Include all the words…
A: The most prevalent form of blood cell, red blood cells, scientifically defined as erythrocytes, are…
Q: What is the name of structure A? What is the name of structure B? B D What is the name of structure…
A: The human respiratory system is a complex network of organs and structures that facilitate the…
Q: A mutagen is an agent that increases the possibility of a mutation and a carcinogen is an…
A: Mutations can occur spontaneously or be induced by various factors, including mutagens. However, not…
Q: 1-Using the above “mean-speed theorem”, calculate the average velocity of a car with constant…
A: The objective of the question is to calculate the average velocity of a car that accelerates from 0…
Q: vvnich of these are true about bone marrow? There may be more than one correct answer. Large numbers…
A: Bone marrow is a tissue found within some of our bones. It plays a critical role in our health by…
Q: 3. If a fish does not produce activator 3 proteins, Pitx1 will be expressed in which of the…
A: The term "activator 3 protein" likely refers to a specific transcription factor or regulatory…
Q: Genomic genealogy websites and services are becoming very popular. Recently a genealogy site was…
A: To determine family links and track ancestry, genomic genealogy uses both conventional genealogical…
Q: The two major types of phagocytic cells are_________ and_________. Select one: a. neutrophils;…
A: The objective of the question is to identify the two major types of phagocytic cells. Phagocytic…
Q: Compare and contrast bacterial artificial chromosomes (BACs) and yeast artificial chromosomes (YACs)…
A: BACBAC is a cloning vector that is specifically used to propagate DNA fragments in Escherichia coli…
Q: can you add words to describe each steps and what has been done please
A: Total RNA is isolated from breast cancer tissue samples and a control sample. Here, control can be…
Q: 3. Which disinfectant would you choose if you were trying to kill both bacterial species? (In other…
A: Chlorine (A) is the disinfectant that works best against both types of bacteria. At 20 mm for…
Q: Please asap
A: The objective of the question is to understand the process of cell division, specifically meiosis,…
Q: Start with a small population (n= 5-50) with the # of populations set to 1. Leave all other…
A: The objective of the question is to understand the effects of different migration rates on a small…
Q: St. Aurelius Augustine, in his theodicy attempting to reconcile freedom and determinism, recognized…
A: The question is asking about the theological implications of St. Aurelius Augustine's theodicy,…
Q: Determine the gene order (which gene is in the middle?), as you were shown in exercises for Tutorial…
A: The image you sent is a question about determining gene order and constructing a genetic map. We…
Q: The first forms of life on Earth were a. plants b. microorganisms c. birds d. dinosaurs
A: The question is asking about the first forms of life that appeared on Earth. This is a fundamental…
Q: Please help me solve it
A: The objective of the question is to identify and arrange the stages of meiosis in the correct order.
Q: UESTION 6 Drosophila, sepia eyes (se) and stubble bristles (sb) are recessive to the wildtype eyes…
A: Genes consist of alleles. When there are two similar alleles in a gene then these are considered as…
Q: The two major types of phagocytic cells are_________ and_________. Select one: a. neutrophils;…
A: The objective of the question is to identify the two major types of phagocytic cells. Phagocytic…
Q: In the Meselson-Stahl experiment, what happened after the E. coli was moved to the N14 medium and…
A: The objective of the question is to understand the results of the Meselson-Stahl experiment after…
Q: To which kingdom would an organism belong if it is Heterotrophic, multicellular, and ingestive
A: The objective of the question is to identify the kingdom to which an organism belongs, given that it…
Q: GQ5
A: The objective of the question is to understand the impact of a deletion mutation on a given DNA…
Q: Why is the Atlantic cod listed as "Vulnerable" on the IUCN Red List of Threatened Species, but only…
A: The objective of the question is to understand the discrepancy between the classification of the…
Q: Please do the following on the topic of Alcohol: -Identify type of pathway of your choosing(Neural…
A: Understanding alcohol's impact on the body's physiological frameworks could be a tremendous and…
Q: If a fish does not produce activator 1 proteins because of a mutation in the gene that encodes those…
A: By activating particular genes, activator 1 proteins regulate the expression of genes. Activator 1…
Q: . If you intercrossed F1 heterozygotes of the form A b / a B in mice, the phenotypic ratio among the…
A: Understanding the relationship between genes, their inheritance patterns, and their physical…
Q: Under which condition would the release of neurotransmitter by bipolar cells attached to cones be…
A: Neurotransmitters are pivotal molecules that facilitate communication within the nervous system,…
Q: If 70% of drunk drivers fail to pass a sobriety test (walking a straight line for 5 meters) in 30…
A: The objective of the question is to determine the specificity and sensitivity of a sobriety test…
Q: GQ7
A: The question is asking to determine the number of exons in a gene given the number of introns. In…
Q: GQ4
A: The objective of the question is to determine the type of mutation that would occur if a specific…
Q: Which of the following is NOT a physiological process linked to the onset of disease? Group of…
A: The objective of the question is to identify which among the given options is not a physiological…
Q: Question 1: In the land between the lakes, Elk and Bison Prairie, we currently have 125 bison and 15…
A: The objective of this question is to find the population size of elk at which the isocline of the…
Q: Two opposing mechanisms determine alveolar expansion:_________ leads to alveolar expansion,…
A: The objective of the question is to identify the two opposing mechanisms that determine alveolar…
Q: Compare and contrast various types of pasteurization technique, considering the temperature and…
A: Pasteurization is a process named after the French scientist Louis Pasteur, fundamentally utilized…
Q: The direct formation of ATP by the transfer of a phosphate group from a donor molecule to ADP is…
A: The question is asking to identify the process by which ATP (adenosine triphosphate) is directly…
Q: Compared to the above urine test, a blood test for glucose is more accurate in avoiding both false…
A: Diabetes is a condition where the blood sugar level remains elevated. It is of two types - type I…
Q: 32. ________ are members of an integral membrane glycoprotein family that bind to specific…
A: The question is asking to identify the type of integral membrane glycoprotein family that has the…
Q: How is the energy used to make ATP via the electron transport chain generated? a. The energy from…
A: The question is asking about the source of energy used to generate ATP (Adenosine Triphosphate) via…
Q: Normal pigmentation dominates no pigmentation (albino). For an organism to exhibit color, it must…
A: So, the bull with the red heterozygous allele has one red allele and one for no color (albino).…
Q: 5. You are given three different substances that are known mutagens. Using a variety of techniques,…
A: The objective of the question is to match each of the three substances with one of the given…
Q: validate Mega CRISPR with CRISPR
A: Mismatch Detection Assay:Mutation Type: Insertion or deletion (INDEL)Assay Description:…
Q: Neuroactive drugs, such as the antidepressant fluoxetine, function by affecting the activity of…
A: Fluoxetine is an antidepressant that acts as a selective serotonin reuptake inhibitor (SSRI). Its…
Q: 3). Which of the following conditions leads to maximal expression of the lac greron? A. lactose…
A: The lac operon is a well-studied genetic regulatory system found in bacteria, namely Escherichia…
Q: For the plasmid below, list the origin and what antibiotic you would use for selection?
A: Plasmid is the extra chromosomal DNA present in prokaryotic cells. It contains information that…
Q: Describe in detail synthesis route (home-cooking recipe) of methamphetamine from pseudoephedrine.…
A: Pseudoephedrine is a drug of the phenethylamine and amphetamine chemical classes. It may be used as…
GQ9
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Question 7 Review translation. Match the term and its description. Each term can only be used once. transfer amino acids to the growing polypeptide in a ribosome |Choose | these base-pairs of a ERNA with a complementary codon on MRNA [ Choose J The two ribosomal subunits (large and small) are made of proteins | Choose | and this RNA called >Question 2. Ribosomes are cellular structures that are composed of protein and RNA; this structure is responsible for catalyzing peptide bond formation between amino acids during a process known as translation. a) Many antibiotics that kill bacteria target translation. Why might this be an effective mechanism to kill bacteria? Why don't antibiotics also kill human (eukaryotic) ribosomes? b) The antibiotic Kasugamycin (KSG) destabilizes the P-site of the ribosome. Describe what parts of translation would be altered in the presence of this antibiotic. c) How does the following graph show the efficacy of translational knockdown with KSG? Met-Methionine C % of Met incorporation 100 80 60 40 20 0 + 0 2 4 6 8 KSG concentration (mg/ml) 10Question 1 All are stages in transcription EXCEPT: A chain termination. B DNase I activity on RNA polymerase/DNA complex. c) binding of RNA polymerase holoenzyme at the promoter sites. chain elongation.
- Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)Question 5A You are doing a genetic engineering experiment. You use restrictions enzymes to cut the regulatory sequences from the lac operon and replace them with the regulatory sequences of the trp operon. Specifically, you will eliminate everything upstream of the beginning of lacZ and replace them with the trp sequences upstream of the beginning of trpE, including trpR. Now, describe the regulation of your ñew constructed gene. What will you do to get expression of the three lac genes? The lac Operon and its Control Elements lacl CAP PO lacz lacY lacA genes 5 binding site 3 DNA AUG AUG AUG messenger RNA RNA polymerase blocked from transcribing trp operon Regulatory gene trp operon DNA PR trpR Ptrp trpE trpD trpC trpB trpA Repressor bound to operator Promoter 5' 3' trpR-MRNA (a) Tryptophan present, repressor bound to operator, operon ropressed. When complexed with tryptophan, the repressor protein produced by the trpR gene binds tightly to the trp operator, thereby preventing RNA…Question: 2. Genes in the same species that have similar related functions are: a. paralogous b. orthologous c. homologous d. heterologous 3. Fill in the blanks: The process of [blank] occurs prior to splicing and changes the [ blank ] of the gene potentially producing a new gene with a related function. 1st blank options: ["exon shuffling", "subfunctionalization", "combinatorial action", "pseudogene construction"] 2nd blank options: ["homeodomain", "domain architecture", "orthology", "multigene family"]
- Question 2: Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown) Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown) Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.Question 1. Enzymes, proteins and deoxyribonucleic acid (DNA) macromolecules. Enzymes are not only speed up the reaction, but also are necessary for DNA repreduction. are important biological a) Compare the process of protein synthesis between eukaryote mRNA and viral RNA b) With the aid of a diagram, draw an adapter molecule that recognizes the codons of mRNA and explain its functions in DNA translation.Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
- Question 5. AP1 is a transcription factor and an important regulator of gene expression and cell proliferation. Dysregulation of AP1 function may lead to cancer. The fos gene codes for AP1. Below is an experiment in which the role of a micro‐RNA (miR‐7b) in the regulation of fos gene expression was studied. miR‐7b shows partial sequence complementarity to the 3′‐untranslated region of fos mRNA. A DNA fragment coding for miR‐7b RNA and another fragment coding for a micro‐RNA unrelated to fos mRNA were cloned into vectors, and the recombinant plasmids (designated si‐miR‐7b, samples 3 and 4, and si‐miR‐neg, samples 5 and 6, respectively, in Fig. 1) were introduced into mouse fibroblast cells. Non-transfected cells were used as controls (samples 1 and 2). Samples 2, 4, and 6, were treated with a chemical PMA that induces transcription of fos gene; samples 1, 3, and 5 were left untreated. Two hours after PMA treatment protein extracts were prepared from the cultures and were then…Question 1. Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. The nucleotide length of each exon and intron is shown. The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence…Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT in the processing of exogenously added siRNAs?