Row A. B. C D. Protein Synthesis in an Animal elect the row below that correctly identifies the name of Process 1 as well as a sequence that could represent Structure 1. Sequence of Structure 1 CGA ATT GTA CAA CGA AUU GUA CAA CGA ATT GTA CAA CGA AUU GUA CAA Process 1 transcription transcription translation translation Structure 1 Process 1 Structure 2 Process 2
Q: determine what type of interaction the example is describing 1. Pilotfish remove and eat parasites…
A: Ecological interactions are the relationships and connections that occur between different organisms…
Q: https://www.khanacademy.org/science/biology/biotech-dna-technology/dna-cloning-tutorial/a/overview-d…
A: Genetic cloning techniques used in the lab and natural genetic recombination processes share some…
Q: The Life Cycle of the Horse Embryo Process 2 Zygote Process Gametes Process 3 Reproductive organs…
A: The life cycle of a horse, like many other sexually reproducing organisms, involves a series of…
Q: 6) of the following metabolic processes, which one is common to or a characteristic of…
A: Photosynthesis is the process by which plants produce their own food by combining water and carbon…
Q: A farmer raising quail, ducks, and chickens switches to a cheaper feed and she notices that hens lay…
A: The egg shells are mainly composed of calcium carbonate. The egg shells provide protection to the…
Q: Membrane potential (mV) -55 Action potential of a neuron in respo stimulus of -55 mV D A B Time
A: Action potential is a fundamental process that occurs in neurons, which are specialized cells…
Q: Why are there so many rRNA gene copies present in the genome?
A: Ribosomes:These are complex cellular structures found in all living organisms which play a crucial…
Q: Succession can be viewed as the effect of ____i____ competition on a community in which ____ii____…
A: Ecology is the study of various species and their interactions with the environment. The term…
Q: Give typing answer with explanation and conclusion The transition to white soil near the end of the…
A: Based on the information provided, it seems that the sudden appearance of new, endemic plant…
Q: 1. How are the divisional names for fungi derived? 2. Fungi are described as decomposers in most…
A: Fungi are a varied category of eukaryotic creatures that serve critical roles in a variety of…
Q: oxygen released from a plant would be a good indicator of the rate of photosynthesis
A: Photosynthesis is a process by which all living organisms get their food directly or indirectly.…
Q: carbohydrates—serve to insulate, protect, and store energy lipids—contain the codes used to…
A: Biomolecules are important in many cellular activities as well as the overall functioning of living…
Q: What comes to mind when people use the term “fat”, What do you think of it as being? Weight? Body…
A: When people use the term "fat," it often carries a wide range of meanings and emotions.…
Q: Pedigree Demonstrating the Inheritance of Myopia Select one: OA. A female who does not have Myopia…
A: A pedigree is a representation of the inheritance of a trait or character or disease from one…
Q: Please read the scenario below and answer the question (in bold) that follows: Spider-Man and…
A: Genotypes refer to the genetic makeup of an individual or organism with respect to specific traits.…
Q: Which of the following statements is correct? Organism Horse Dog Cat Human Select one: OA. The ovum…
A: Chromosomes are thread-like structures found within the cells of living organisms, carrying genetic…
Q: or s The diagram above illustrates the process of statement) Row А. B. C. D. i translation…
A: Translation is the process by which RNA is used to make proteins.Transcription is the process of…
Q: The difference between the channels along the axon and the channels in the axon terminal is that?…
A: In the realm of neuronal communication, various ion channels play essential roles in transmitting…
Q: Which of the following fungi is known to cause yeast infections? O C. albicans R. stolonifer O A.…
A: *Yeast infections can be commonly known as candidiasis, which are frequent fungal infections caused…
Q: Select the row below that correctly identifies the genotype and phenotype of an individual who is…
A: Alleles are the alternative forms of a gene. A single gene has two alleles, one is dominant and…
Q: out of t If one of the parents is found to have the mutation that causes DAD, it is most likely the…
A: Diabetes mellitus and deafness (DAD) is a genetic disorder caused by a specific point mutation at…
Q: Label the structures of a motor (multipolar) neuron by clicking and dragging the labels to the…
A: Neurons can be divided into unipolar, bipolar and multipolar neurons. Neurons transmits information…
Q: Learning Task 09-1: Treatment of Gastrointestinal Disease Use the links provided in the next few…
A: This learning task will investigate different treatment methods for gastrointestinal infections.…
Q: Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the…
A: A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or protein…
Q: Please read the scenario below and answer the question (in bold) that follows: Spider-Man and…
A: The answer is (c). Spider-Man can produce SS, SC, sC, and sc gametes.Spider-Man can produce four…
Q: Suppose that the X-linked recessive condition hemophilia A affects 1 in 5000 males in the United…
A: The equation is typically expressed as: p^2 + 2pq + q^2 = 1Here:1. p represents the frequency of one…
Q: Please match the terms regarding immunotherapies with their definitions. Please match the terms…
A: Let's match the following:
Q: Give typing answer with explanation and conclusion In general terms, describe the sequence of events…
A: The production of proteins in human cells is a complex process that involves multiple steps and…
Q: A female with the genotype t* t r¹ r s* sis crossed with an XY male. The F₂ generation is below.…
A: The condition where only a single copy of the gene is found in the diploid cells is called a…
Q: Select all that apply: Which of the cells kill in the same manner? ONK cells Regulartory T cells O…
A: NK cells are a type of lymphocyte, which is a white blood cell involved in the immune response. NK…
Q: The anterior and posterior lobes of the pituitary differ in that. View Available Hint(s) O the…
A: Pituitary gland is one of the most important gland of the body located in the sella tursica. It has…
Q: 9 Collectively, chromosomes 1-5 may be referred to as elect one: Karyotype of Drosophila…
A: Chromosomes are thread-like structures located inside the nucleus of animal and plant cells. Each…
Q: n fruit flies, eye color is a sex-linked trait, and red eyes (the wild-type variant) are dominant to…
A: When only one set of chromosomes from a chromosomal pair is present, it is said that a gene is…
Q: what will be the end result of plant growth under sun and those under shade. Explain in two…
A: plants adapt to varying light environments is a remarkable feat. From sun-drenched expanses to…
Q: 4. Suppose you conduct the experiment and achieve the following results (assume adequate…
A: PSTI is Pancreatic Secretory Trypsin Inhibitor. It is also known as Serine protease inhibitor Kazal…
Q: Syphilis is caused by this bacterium. O S. enterica O V. cholerae O S. dysenteriae O S. typhi O T.…
A: Bacteria are small, unicellular organisms. They are prokaryotic and don't have a nucleus, nuclear…
Q: Following a mutagenesis experiment to identify novel genes affecting the circadian clock in…
A: Genotype refers to the genetic makeup of an individual organism, specifically the combination of…
Q: Answer Bank stimulates secretion of pancreatic enzymes in response to stomach distension causes the…
A: First of all we need to understand what the functions of these hormones and neurotranamitter (…
Q: Match the relationships to the corresponding concepts. Expanding nucleotide repeat Somatic mutation…
A: Mutation refers to a process in genetics and biology where there is a permanent change in the DNA…
Q: eye trait. Assume that the flies have a diploid set of autosomes (2A). Allele X" codes for white…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: In humans, hemophilia is an X-linked recessive condition characterized by the inability of blood to…
A: Genotype is the genetic constitution of an organism for any character and the phenotype is the…
Q: Which of the following diseases specifically targets the immune system, making people susceptible to…
A: There are a lot of diseases that affects the immune system. Our immune system is composed of a…
Q: The reproductive structures that are affected by CAVD are Select one: OA. b, f and g O B. d, g, and…
A: Congenital Bilateral Absence of the Vas Deferens, a condition affecting male reproductive structures…
Q: Patients who have recently had a bone marrow transplant are extremely susceptible to infection. Why…
A: In the spongy or cancellous regions of bones, bone marrow can be found. It is a semi-solid tissue.…
Q: Please answer the questions below completely AND correctly
A: Autotrophic and heterotrophic protists represent two distinct nutritional strategies within the…
Q: Arrange the balanced biochemical equations for all the reactions in the catabolism of glucose to two…
A: Respiration is an amphibolic process which occurs in the cytoplasm mitochondrial matrix and…
Q: How can you determine if there is anything wrong with your anterior cruciate ligament (ACL)?
A: ACL stands for anterior cruciate ligament, is strong band of tissue which connects our thigh bone…
Q: conclusion 16.Reproductive barriers can evolve and cause speciation as a result of which…
A: Reproductive barriers can give rise to reproductive isolation and eventually to the evolution of two…
Q: Use the following information to answer the next question. O a 1,2,3 and 4 Ob 2 and 3 Oc 1 only O d.…
A: The body's most sophisticated control and coordination centre is located in your hypothalamus, a…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 4 steps
- Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled ‘Biological Assembly.â€� click “More Images.â€� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?Chart is Given for you: Below is a chart of values for actual enzymes. Enzyme Km (M) kcat (1/s)Chymotrypsin 1.5 × 10^−2 0.14Pepsin 3.0 × 10^−4 0.5Tyrosyl-tRNA synthetase 9.0 × 10^−4 7.6Ribonuclease 7.9 × 10^−3 7.9 × 10^2Carbonic anhydrase 2.6 × 10^−2 4.0 × 10^5Fumarase 5.0 × 10^−6 8.0 × 10^2 Assume the enzyme concentration is equal across all samples (and is equal to 1). (Answer a and b only)a. Which enzyme will have the highest V0 at very high substrate concentrations? (1 M). Why? b. Which will have the highest V0 at very low substrate concentrations (5.0 × 10^−12). Why?
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…e.) ( acid buffer an appropriate choice? Why or why not? If I need to perform an enzymatic reaction at pH 6.5, is a citric )Describe the process of transcription in as much detail as possible using pictures and words beginning with a paired (duplexed) strand of DNA and ending with a processed mRNA which is ready for translation. 7.
- You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomeDNA, RNA, AND PROTEIN SYNTHESIS (FILL IN THE BLANKS) GIVEN THE FOLLOWING CODING SEQUENCE FOR DNA, PROVIDE THE SEQUENCE OF THE COMPLEMENTARY(TEMPLATE) SEQUENCE. CODING SEQUENCE/ 5' ATGCATAGATTAGGATATCCCAGATAG 3' COMPLEMENTARY SEQUENCE: 3' ______________________________ 5' CODING SEQUENCE ~ mRNA transcript: 5' _______________________ 3' TRANSLATE THE GIVEN mRNA TRANSCRIPT INTO A POLYPEPTIDE SEQUENCE (REFER TO THE GENETIC CODE) POLYPEPTIDE SEQUENCE: _________________________________Given: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity of the protein? 2. What is the importance of this protein?
- proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.4A. Write out the chemical equations (structures are not necessary) for the two steps in the reaction catalyzed by aminoacyl tRNA transferase. Include all products and reactants. Step 1: amino acid activation Step 2: aminoacyl transfer to the tRNA 4B. Write the chemical equation for the net reaction catalyzed by aminoacyl transferase. This can be determined by taking the sum of the two reactions above.8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…