You are working in a research lab studying human Peptide Z, which is a short protein that plays a key role in responding toSARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), butshe neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical.5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3'3'-TCT GGG TẠC GGA GTC GTC AAG AAA CCT AAT TẠC ATT-5'Using your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strandis the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.)What is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed.5' -- 3'What is the amino acid sequence of Peptide Z? Make sure you indicate the carboxyl-terminus and amino-terminus with Cand N, respectively.

Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but he neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3' -TCT GGG TAC GGA GTC GTC AAG AAA CCT AAT TAC ATT-5' Jsing your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand s the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) Vhat is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. - 3' Vhat is the amino acid sequence of Peptide Z? Make sure vou indicate the carboxyl-terminus and amino-terminus with C

SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but he neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3' -TCT GGG TAC GGA GTC GTC AAG AAA CCT AAT TAC ATT-5' Jsing your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand s the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) Vhat is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. - 3' Vhat is the amino acid sequence of Peptide Z? Make sure vou indicate the carboxyl-terminus and amino-terminus with C

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
given below is a small slice of a large sequence of protein taken from ORF1a polyprotein of Severe acute respiratory syndrome coronavirus 2 (isolate: wuhan-1). Convert the following sequence into protein strand using one letter code: 5'-ACCAACCAACTTTCGATCTCTTGTAGATCT-3'
EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein
To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…
Remdesivir is an antiviral drug used to treat SARS-CoV-2 infections. It is a broad-spectrum antiviral, meaning it has activity against many different viruses. Remdesivir can be incorporated into a new RNA chain as a virus replicates and can interfere with the viral replication machinery. Template RNA Elongation New RNA SARS-CoV-2 RNA polymerase Template groove Nucleotide entrance Nucleotides Remdesivir Figure 1. A representation of remdesivir and the viral replication machinery for SARS-CoV-2. 6. Figure 1 shows that remdesivir "mimics” an important component of RNA replication. Which specific component of RNA replication has a structure like that of remdesivir? 7. Propose a hypothesis about how remdesivir might inhibit the virus's replication process.
Within the long-terminal repeat in the retrovirus genome is a PBS. If the PBS was mutated such that the molecule could no longer bind, what consequence would this have on the retrovirus life-cycle? Explain your answer. TTTT Paragraph Arial v a (12pt) E- E. T OIX8
Е. F. С. D. A. B. COMPLEMENTARY BASE PAIRING 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus X174: ATG T GT CA AAGACGGT Dayonna Rucker C C T G T T T T G T A CCGTCAGGATTGA G T T T T C A T G C CТССАААТСТТ
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
Human immunodeficiency virus (HIV), the causative agent of acquired immune deficiency syndrome (AIDS) infects T-helper cells that have the CD4 receptor on their surface: gp120 RNA- Core with protein coat Envelope (a) Structure of HIV Copyright © 2001 Benjamin Cummings, an imprint of Addison Wesley Longman, Inc. Edit View Insert Format Tools Table 12pt Paragraph -Reverse transcriptase enzyme B -Capsomeres of protein coat I U Αν 2 T cell A. As shown in the above diagram, HIV attaches to a susceptible cell by a binding interaction between the gp120 protein on the virus protein and the CD4 and CXCR4 receptors on the surface of the T-helper cell. What will be the next event in the virus life cycle? B. One mechanism for transmission of HIV is direct contact during sexual activity. What is the other common mechanism of transmission? over DNA (b) HIV infecting a T cell with CD4 receptors, and CXCR4 coreceptors which are distributed over the surface of the cell T² v -CD4 receptor -CXCR4…
Can you please pick the right answer in each parentheses? The spike protein of SARS-CoV-2 is a carbohydrate-modified protein that ["bind the RNA genome of the virus", "", "is on the surface of the viral particle", ""] and plays a role in both ["replication of the viral genome", "recognition of host cell"] and ["packaging of viral genome for export", "fusion of viral envelope with host cell plasma membrane"] . Importantly, earlier work on spike proteins from other corona viruses showed that this molecule ["remarkable resistance to immune response", "shows remarkable conformational changes"] and only one of these served as a good antigen for vaccine development. A critical discovery in advancing the development of our current vaccines was determining what changes in the amino acid sequence would ["block degradation of the spike protein", "stabilize the conformation of the protein found on the viral particle"]. This…
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Name a nucleoside analog. Explain how that nucleoside analog works. Which viruses are effectively treated by that nucleoside analog?