SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A *

SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M, enter M N/A N/A N/A N/A

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Suppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:
Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letter
Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAG