Q: 1. TLR recognition induces APCS to: I. Stop pinocytosis/phagocytosis II. Decrease expression of MHC…
A: The immune system is a complicated physiological system comprised of several organs, tissues, and…
Q: Current models regarding the dispersal of modern humans indicate that O Modern humans evolved in…
A: Man is a product of evolution. As a result, human evolution is inextricably linked to the genesis of…
Q: f all the Petri dishes/agar plates grew bacteria, including the control, what do you think could be…
A: Bacteria: Bacteria are single-celled organisms that are tiny. Bacteria can be found practically…
Q: Virology:Describe how to make an attenuated virus vaccine by briefly describing each step(1-4) in…
A: Live and attenuated vaccines are obtained from “wild” viruses or bacteria. By the help of repeated…
Q: 51. Pyramids of energy, biomass and numbers can be inverted in some ecosystems, particularly in…
A: A graphical depiction of the biomass or bioproductivity at each trophic level in a particular…
Q: A large percentage pf living species on earth live in tropical rainforests of the world. Why are so…
A: Biome is a region in which different group of organisms like plants or animals residing in a…
Q: Biology In your own words describe how antisense RNA is used to regulate translation. Include…
A: Most antisense RNAs in bacteria inhibit translation by competing with ribosomes for translation…
Q: What are the SIMILARITIES of Plants and Animals when it comes to BODY FLUID REGULATION.
A: Intracellular and extracellular components make up the fluid compartments of animals. Body cells and…
Q: The major intrinsic protein responsible for the passage of water through cell membranes is O…
A: ANSWER;-Aquaporins Explain;- Aquaporins, likewise called water channels, are channel proteins from…
Q: According to your textbook, the first species of hominin to migrate out of Africa was. O…
A: Introduction :- Any member of the taxonomic "tribe" Hominini, of which only one species, Homo…
Q: PART B: Vesicular Transport D plasma membrane nuclear envelope C ENDOCYTOSIS endoplasmic reticulum…
A: Introduction In eukaryotic cells, vesicular transport is the most common mode of protein and lipid…
Q: The G-proteins associated with GPCRS are made up of three subunits. In order to become active they…
A: G protein ha three subunit- Alpha Beta Gamma
Q: Which of the following hominins had a brain size very similar to that of Homo sapiens? O…
A: Modern humans relate to the Homo sapiens species, that has a brain size of roughly 1400 cubic…
Q: Bipedal locomotion preceded the appearance of large brains over the course of hominid evolution True…
A: When organisms started walking on two legs then this movement is called bipedal locomotion. Out of…
Q: Thờ term 'mitochondrial eve' refers to O The first human woman O The last human woman who all modern…
A: Humans inherit the mitochondrial DNA only from the mother . So inorder to pass the mtDNA through…
Q: Many noncoding RNAS take a complex stem and loop secondary structure. Which statement best describes…
A: RNA doesn't form any hydrogen bond or covalent bond between phosphate or nitrogenous base. So,…
Q: सक to Haw do we भ क सम्प कण different islands? 18land 3 1sland 4 Species toland 1 Island 2 104 78 65…
A: Beta diversity measures the change in diversity of species between environments. Simply, it…
Q: Match each term with the best description. 1. natural selection 2. domesticated 3. intentional…
A: Answer :- 1.natural selection - when the environment is the controlling agent In which organisms are…
Q: identify A b
A: Electric current geberated by heart is recorded by Electrode. 5 peaks are found . Like : P wave…
Q: The is a protruding area above the eyes found in many archaic human species. This is a feature that…
A: Introduction Human evolution:- It is the lengthy process by which human beings developed on Earth…
Q: There are seven conditions needed to maintain Hardy-Weinberg equilibrium. What is the likelihood…
A: Hardy-Weinberg Equilibrium is a concept that serves as a benchmark for researchers to analyze gene…
Q: Question 11 Lee Ann has two fish. One is heterozygous for orange color, and the other is homozy-…
A: Given: R - orange color and r - black color Genotype of the two fishes: Heterozygous for orange…
Q: Please answer the following question(s): 1. True or false: Unlike lectins, scavenger receptors only…
A: Scavengers receptors recognises only microbial infection Answer False statement
Q: How do humans contribute to ocean acidification/decreasing ocean pH and what is the backfire of this…
A: Introduction :- The capture of carbon dioxide from the atmosphere causes ocean acidification, which…
Q: Function outside metabolism is the generation of: a-chemical energy b-structural precursors C-…
A: Function outside metabolism is the generation of?
Q: What is the importance of agar plates and bacteria cultures in food microbiology?
A: Answer
Q: Question 8 Protein synthesis is also known as, Blank 1 Blank 1 Add your answer
A:
Q: The Van't Hoff equation estimates the Ws of a solution. True False
A: Van't Hoff equation determine the change in entropy and enthalpy of a chemical reaction.
Q: Why are whisk ferns and horsetails now classified as ferns?
A: The characteristics of ferns are- They have vascular tissues. The produce by spores production.…
Q: Biology In your own words describe how antisense RNA is used to regulate translation. Include…
A: Rna is a type of genetic material mostly found in prokaryotic animals like bacteria and viruses .
Q: In one paragraph, using your own words, describe how natural selection led to polar bears evolving…
A: Introduction :- Natural selection is the process by which individuals with different phenotypes…
Q: DNA mismatch repair enzymes preferentially repair bases on the newly synthesized DNA strand, using…
A: DNA mismatch repair enzymes play an important role in maintaining the accuracy of DNA replication.…
Q: To determine: Environmental factors that are most important in determining the adaptations of…
A: Ecosystems are self-sustaining communities of living organisms that interact with their…
Q: What is the purpose of the oil in determining the transpiration of a plant? How will it affect the…
A: Stomata are the tiny pores that are present on the surface of the leaf. It has two functions firstly…
Q: List and briefly explain at least three examples of pseudoscience that are related to or attempt to…
A: Pseudoscience: It is a proposition, a find a systemor a finding of explanation that is presented…
Q: Which property of phospholipids is responsible for the formation of phospholipid bilayers?
A: All cells are enclosed by a plasma membrane that forms a barrier between the cell and its…
Q: In some autoimmune diseases, an individual develops antibodies that recognize cell constituents such…
A:
Q: Which of the following changes would cause directional selection? a A habitat made of trees with…
A: Directional selection This selection takes place when organisms having characteristics represented…
Q: Protein synthesis is also known as Blank 1 Blank 1 Add your answer
A: Introduction Proteins are complex molecules that are found in all living organisms. Proteins have a…
Q: 24 "Hydroelectric Dam" from "Hydroelectric Dam" The picture below is a simple diagram of a…
A: Gravitational energy Motion
Q: Biology Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was…
A: DNA sequencing reveals the arrangement of nucleotide bases in a DNA segment. Because each human and…
Q: Question 5 The initiation of protein synthesis or regulation of gene expression can be controlled by…
A: Protein synthesis is the interaction wherein cells make proteins. It happens in two phases:…
Q: Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was…
A: Ion Torrent sequencing is also known as Ion semiconductor sequencing, pH-mediated sequencing,…
Q: What do the holes in the plate represent? Name the virus involve in this experiment
A: Escherichia coli is a bacteria that is found in many foods and some environmental conditions.
Q: 1. Which of the following PAMPS do scavenger receptors mainly recognize? O a. Flagellin b.…
A: Here i discuss the questions regarding pathogens associated molecular patterns and scavenger…
Q: Does RNA polymerase have exonuclease activities?
A: The full form of DNA is Deoxyribonucleic acid and that of RNA is Ribonucleic acid. DNA and RNA both…
Q: Biology Does RNA polymerase have exonuclease activities?
A: Recent studies illustrated, RNA polymerase II is involved in 3'-->5' exonuclease activity. It…
Q: A farmer only breeds cows that produce a lot of milk. This is because the farmer wants more cows…
A: In this case certain traits are high milk producing capacity of cows. These certain traits are…
Q: a. On the graph, use horizontal lines to indicate the level of potential energy that each of the…
A:
Q: Which of the following is a role of CLRS in host recognition? O a. Direct cell killing O b. Cell to…
A: C Type Lectin Receptors The CLRs or the C type Lectin Receptors are pathogen recognition receptors…
Step by step
Solved in 2 steps
- I need help answering the following question from the following article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2762880/ Science and Society: In 1966, Stanley Gartler presented his findings at an international conference- 18 of the most commonly used cell lines all contained the same genetic marker, G6PD-A. This gene allele is found almost exclusively in African Americans. This was a problem because a large number of these cell lines, excluding HeLa cells, were established from Caucasian individuals. He suggested that these lines were in fact contaminated with HeLa cells, which proliferate at extreme rates and were used in labs all over the world. What would you expect was the response of those scientists using the “contaminated” cell lines? Do you think this marker is enough to establish this contamination?ocument/d/1J-wo90GpYsd_jQSUBtDQHWisqGvSOteUQYoXaXazyS0/edit uction to cell.. R 1 Summary of Philo... E Petrona Andres Mig.. 2 Translations IXL: Par... IXL - Translations: g.. 1 IXL- meostasis Lab Exercise Tools Add-ons Help Last edit was 2 days ago text Calibri 12 BIU Conclusion: 1. List the changes you observed in the body color and perspiration level in response to? 2. Explain how the changes help the body adjust to maintain equilibrium (homeostasis)? 3. Speculate why a change in body temperature occurs? 4. Name which mechanisms your body uses to maintain a constant body temperature? 5. Explain why an increased breathing rate accompanies exercise? 6. Explain why an increased heart rate accompanies exercise? 7. Write a paragraph about the conclusions you can draw about your body's ability to maintain equilibrium (homeostasis). Be sure to include the answers to the questions above.A web.lrnr.us/courses/6241c4b1-ef4f-41db-8549-34b0c315b9f4/assignments/da0b072b-ad10-40b1-a0cb-ecc2d2baf7f5/activities/c04d4b52-bb67- irrnr laquajajones Courses > Human AP I Laboratory > Assignments > 01 Microscope Lmr HW > Peering Into the Invisible World C9 Peering Into the Invisible World FIB with muitiple drop down entries 0. My Fill in the blanks, using the choices provided, to correctly identify the contributions to the Cell Theory. G2 In the late 1600s, a Dutch tailor who crafted lenses, used his primitive microscope to view pond water, the plaque In 1665, from his own oral cavity, as well as his own sperm. He referred to all of the organisms he viewed as coined the term to describe the cork tissue he was observing through a lens. You sign 91°F P Type here to search
- A web.lrnr.us/courses/6241c4b1-ef4f-41db-8549-34b0c315b9f4/assignments/da0b072b-ad10-40b1-a0cb-ecc2d2baf7f5/activities/c04d4b52-bb67- irrnr laquajajones Courses > Human AP I Laboratory > Assignments > 01 Microscope Lnr HW > Peering Into the Invisible World C) Peering Into the Invisible World FIB with muitiple drop down entries 0. My Fill in the blanks, using the choices provided, to correctly identify the contributions to the Cell Theory. G2 In the late 1600s, a Dutch tailor who crafted lenses, used his primitive microscope to view pond water, the plaque In 1665, from his own oral cavity, as well as his own sperm. He referred to all of the organisms he viewed as coined the term to describe the cork tissue he was observing through a lens. You sign 91°F P Type here to searchWhat is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3how do i expand this into 1000 words The objective is to interpret the results of an RNA-Seq analysis to identify differentially expressed genes in breast cancer using figure 1. The data provided includes gene symbols, chromosome location, start and end points, strand, fold change, log2 fold change, p-value, and false discovery rate (FDR). The RNA-Seq analysis has identified several genes that are differentially expressed in breast cancer. These genes are located on various chromosomes and have varying levels of fold change, indicating the degree to which their expression levels differ between normal and cancerous cells. The gene with the highest fold change is EYA4, located on chromosome 6, with a fold change of 3604.4176. This indicates that the expression of this gene is over 3600 times higher in cancer cells compared to normal cells. The log2 fold change is 11.81555, which is a measure of the magnitude of the difference in gene expression. The p-value for this gene is extremely low…
- 10- 00 O SCNSA-SCN10A CDKN1A HANDI VTI1A SYTI • MYOCD 9 10 11 12 13 14 15 16 17 18 19 20 2122 X YIn cancerous cells, CpG islands are: where intercalating agents are found demethylated methylatedMatch the protein on the left with its primary role on the right PINK LAMP2A BCL2 ATF6 [Choose] [Choose] promoting UPR promoting apoptosis inhibiting autophagy inhibiting UPR inhibiting apoptosis mitophagy nonselective autophagy chaperone mediate autophagy [Choose]
- L A Moving to another question will save this response. Question 5 Select the correct statements 0 An oncogene is a cancer producing gene A proto-oncogene is only found in cancer cells Tumor suppressor genes are genes whose normal products inhibit cell division A proto-oncogene is a normal cellular gene that has the potential to become an oncogene A Moving to another question will save this response.how do i expand this into 1000 words for a result section of a report The objective is to interpret the results of an RNA-Seq analysis to identify differentially expressed genes in breast cancer using figure 1. The data provided includes gene symbols, chromosome location, start and end points, strand, fold change, log2 fold change, p-value, and false discovery rate (FDR). The RNA-Seq analysis has identified several genes that are differentially expressed in breast cancer. These genes are located on various chromosomes and have varying levels of fold change, indicating the degree to which their expression levels differ between normal and cancerous cells. The gene with the highest fold change is EYA4, located on chromosome 6, with a fold change of 3604.4176. This indicates that the expression of this gene is over 3600 times higher in cancer cells compared to normal cells. The log2 fold change is 11.81555, which is a measure of the magnitude of the difference in gene expression. The…personal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... O Search (Option + Q) Review View Help Editing v A BI U Ov =<=v 三 v ... Question 13 Zinc finger nuclease is a Gene editing tool: which uses a site-specific endonucleases containing a DNA-cleavage domain and a modular DNA-binding domain RNA-guided endonucleases programmable nucleases Exonuclease Question 14 Which elements are required for DNA to behave as a chromosome in yeast cells: a centromere an autonomous replicating sequence two telomeres Antibiotic selection marker Question 15 A series of such clones where the insert of each clone partially overlaps that of its neighbors with no gaps is known as a Clone Contig DNA fingerprinting A tiling path Genome MacBook Pro