Q: Which of the following would be a normal gamete? a. 23Y b. 22X c. 46XY d. 46X
A: The karyotype of the human somatic cell is - 46 XX or [44 A + XX] for females 46XY or [44 A + XY]…
Q: In eukaryotes, Cot DNA reassociation curves are not smooth. They have bumps. Why? What are the…
A: Genome of an organism can be defined as a sum total of all the genetic material present in it.Genome…
Q: eed Diabetes descriptions, introductions, and side effects and statistics and prevalance amongst…
A: Introduction: Polydipsia, polyphagia, and high blood glucose levels (hyperglycemia) are the main…
Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…
A: The size of the island and its position is very much crucial for species richness. There are several…
Q: adolescence, the number of red blood cells _____ in _____. a. increases; both girls and boys b.…
A: Red blood cell production mainly occurs in the bone marrow. The main stimulant that helps in the…
Q: People can also get tested for the presence of SARS-CoV-2 antibodies. Explain how an individual…
A: The coronavirus virus, which causes coronavirus illness, 19 (COVID-19). The coronaviruses are a…
Q: Explain what tuberculosis is, including the cause, how it affects the person, as well as how it is…
A: Respiratory system is a type of body system which is involved in exchange of gases. This means…
Q: Some hospitals concurrently review records for deficiencies others review retrospectively. Explain…
A: Some hospitals simultaneously check records for errors while others do so retrospectively,…
Q: How to improve the insulin pump “t:slim”, its effectiveness and transport ?
A: The t:slim X2 insulin pump is a smart gadget that releases insulin into the body automatically. It…
Q: Agrobacterium tumefaciens is ... Question 61 options: a family of transposable elements found…
A: Genetic engineering is a process in which genetic makeup of an organism altered by introduction of…
Q: State and recognize the three basic nutritional needs an organism’s diet must satisfy. List the…
A: Food consists of nutrients. Nutrients is categorised into seven major groups carbohydrates,…
Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…
A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…
Q: The three forms of the anthocvanins in red cab.-bage extract are red, blue, and yellow. How do you…
A: Anthocyanin are the coloured pigments which are present in many plants including cabbage that…
Q: Identify the parts in these plant and animal cells. Human cheek cell, 400x Outermost layer Animal…
A: Image in left upper corner: As human cheek cell is an animal cell, the organelle that contains DNA…
Q: You can expect to observe a _______ lower VO2max value on a cycle ergometer compared to a treadmill.
A: introduction VO2 max measures how much oxygen is breathe during exercising depend on your…
Q: In Deuterostomes, nutrient molecules (monomers) are taken in to the space between the endoderm and…
A: Option (a) is incorrect because, in Deuterostomes, nutrient molecules (monomers) are taken up into…
Q: 2. On the replication bubble below, draw the newly synthesized strands of DNA as they would be seen…
A: DNA replication occurs at body temperature (37 degrees Celsius in humans) with the assistance of a…
Q: Explain the difference between an ecosystem and a habitat. Why are some microbial habitats…
A: Introduction: Our biosphere exhibits enormous diversity at all levels of biological structure, from…
Q: What is diabetes type 1 and 2 and why does it occur ? and what is the tole of insulin pump for…
A: Insulin is a hormone, which is secreted by the pancreas which regulate the sugar in the body.
Q: Procedure 1. 2. 3. 4. 5. 6. Fill in the data table below. Complete column B by writing the correct…
A: Process of synthesis of RNA from DNA is known as transcription. As the colum A in the table…
Q: Tell me how this image shows the relation between grape and banana
A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…
Q: using environmental DNA (eDNA), instead of traditional field-based capture techniques, to study…
A: e DNA or environmental DNA is the presence of DNA of an organism in a particular region. Each and…
Q: Label the images provided ---->(cell nucleus/nuclei, epithelium, connective tissue, muscle,…
A: Blood vessels are the tube through which the blood circulates in the body of the organism. It…
Q: Glycolysis occurs in what part of the cell? O eukaryotes: inner membrane of mitochondria;…
A: Glycolysis is a sequential process of breakdown of glucose in the presence of oxygen to synthesize…
Q: Read each description on top regarding the different levels of the visual projection pathway. Then…
A: Check the answer below:
Q: What can lead to mTOR inhil AKT OTSC1/2 active ☐ Exercise
A: Intracellular signaling happens between cells in different ways. Ligands that are hydrophilic in…
Q: 4.08 H H ↓ 1.02 ↓ | 2.54 11.02↑ E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H…
A: Endonuclease HindIII is a type II restriction enzyme that recognizes and cleaves the palindromic…
Q: Please explain the difference between complete androgen insensitivity and pe-nis at 12 syndrome.…
A: An uncommon genetic condition of sexual development is known as androgen insensitivity syndrome…
Q: Which is not true of Eukaryotic cells? A) A true nucleus contains DNA in the form of chromosomes B)…
A: In our body, there are billions of cells. While no two cells are identical, there are numerous…
Q: Which of the following is FALSE in processing DNA sequences using MEGA? Raw DNA sequences must…
A: The Molecular Evolutionary Genetics Analysis(MEGA) is a software that is developed for comparative…
Q: A unique identifier of a sequence deposited in GenBank. OE-value O Voucher number Accession number…
A: What is the Genebank database? GenBank is a database that contains publicly available nucleotide…
Q: How do virus infection and chemicals may cause cancer? Give examples and mechanisms.
A: A virus can only replicate and create new viruses by entering a live cell and taking control of the…
Q: Sample 1 Sample 2 Sample 3 Semp Sample 5 Is there DNA evidence to support the arrest of the accused…
A: DNA is unique to an individual. DNA fingerprinting also known as DNA profiling, is a technique of…
Q: 5. › Polyphenoloxidase is involved in the darkening of wheat products due to its oxidative effect on…
A: Enzymes are biocatalysts which increase the rate of chemical reaction by decreasing the activation…
Q: I know that Enterobacter Clocoae was supposed to test positive for the catalase test. My test…
A: Enterobacter Clocoae is gram negative bacteria, it is rod shape bacteria that has flagella all over…
Q: What is evolution? What is adaptation?
A: Dear students, as per the QnA guidelines of bartleby, we are not permitted to write essays. I am…
Q: Imagine you are planning to visit a family member who is a nursing home resident. The nursing home…
A: In that case we have to test RT-PCR test
Q: Which of the following features is NOT a characteristic of ALL animals? Self-propelled movement…
A: Introduction:- Living Organisms are classified into various groups on the basis of presence or…
Q: How does luciferin bind to the estrogen receptor if the drug tamoxifen is used to inhibit estrogen…
A: Tamoxifen binds to the estrogen receptor but does not fully activate it, stopping the growth that…
Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…
A: This activity is about different types of living beings which have different characteristics such as…
Q: In the fungi life cycle, spores can be produced via: a. mitosis b. meiosis Oc. karyogamy d. A and B…
A: Fungi reproduce sexually and/or asexually. Perfect fungi reproduce both sexually and asexually,…
Q: Below is a table of allele frequencies. Locus 1 Freq(116) = 0.3 Freq(120) = 0.4 Freq(124) = 0.3…
A: Gene frequency is the proportion of a specific gene or allele that is repeated over time in a given…
Q: Can we just insert a gene on an organism? - In plants, the use of Agrobacterium, we're there any…
A: Transfer of genes is a common component of genetic engineering projects, i. e. DNA transfer between…
Q: 4. Compare and contrast ESCs and iPSCS by considering the following: B) List two ethical…
A: Stem cells: The human body is composed of multiple cell types that perform various functions. One…
Q: which of the following is NOT a possible source of the monomer building blocks in the RNA world…
A: RNA world hypothesis assumes the formation of early living beings which uses RNA as genetic…
Q: Describe the structure and composition of viruses. What are three reasons that they are different…
A: In nature there are many ultra microscopic particles known as viruses. A virus is small particle…
Q: Create a word doc concept map
A: Concept may using the words givrn in the two pictures is given in step 2.
Q: Distinguish between skeletal, smooth, and cardiac muscle in terms of location and whether they have…
A: Introduction:- A tissue is defined as the group of cells that have similiar structure and functions…
Q: If you perform a Chi-Squared analysis and determine that your result is greater than the critical…
A: Ans: Chi- square analysis is a statistical hypothesis test to determine the relationship between the…
Q: need a full description of insulin pump and how can be effective on certain types of diabetes and…
A: Diabetes mellitus Or type II diabetes mainly occurs due to the deficiency of insulin secreted by the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First PositionA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
- he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
- Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, GlycineUsing the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -TerminationFor each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon table as needed. 5'-AUU-3' anticodon: 3'- -5' amino acid: 5' -UCU-3' anticodon: 3'- -5' amino acid: 5' -CAG-3' anticodon: 3'- -5' amino acid:
- Give the complementary codons, anticodons, and amino acids for the following: - ATG - CCA-AGG-GCT - ACT Code: TAC-TCG-CGC-ACC-GTA-TGC Give the complementary code, anticodons, and amino acids for the following: Codon: AUG - UCA - UCU - CGU - UAC - CCU - GCC-ACU-GCA - CUG - UAG Give the complementary code, codons, and amino acids for the following: Anticodon : UAC – CUA – GAC – AUG – GGG – CAU – UGG – CCA – GCA – AUU Complete the following tables: CODE: T-A-C A-T-G C-C-G T-G-G A-A-T C-G-C A-T-T CODON: ANTICODON: AMINO ACID: CODE: CODON: ANTICODON: U-A-C A-U-G U-U-C C-G-A AMINO ACID: CODE: CODON: A-U-G ANTICODON AMINO ACID: T-T-A C-C-U A-U-C A-U-C C-C-U A-C-U C-U-G T-A-C U-A-GAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU