What is the one-letter amino acid sequence formed from the following mRNA that codes for a pentapeptide that is an endorphin called Leu-enkephalin? 5' AUG - UAC - GGU - GGA - UUU - CUA - UAA 3'
Q: Q.11. How will plasma creatinine and creatinine processing in the kidney be affected as a result of…
A: The rate at which a substance is taken from the blood by the kidneys and eliminated in the urine is…
Q: How many ml is needed to fill this prescription Gabapentin liquid 300mg/5ml 300 mg po TID x 30…
A: In this exercise, we'll figure out how much fluid gabapentin is required to total a patient's…
Q: what are the benefits of scoring a 9mm skinfold calliper test in sports
A: The 9mm skinfold calliper test is an easy, non-invasive way to determine composition of subcutaneous…
Q: 8. What is a vaccine? Why are most recommended in the first few years of life?
A: A vaccine is a biological preparation that provides active acquired immunity to a particular…
Q: Provide examples of negative and positive feedback in the regulation of the ovulatory cycle.
A: The rhythmic monthly cycle of hormones and changes in the ovaries and uterus of the females is…
Q: 2. Achondroplastic dwarfism is a dominant genetic trait that causes severe malformation of the…
A: Inheritance pattern is a type of pattern which determines how traits are passed on from parental…
Q: Choose the most accurate characteristic of B cells. A) They help establish and control the…
A: B cells are a type of white blood cell that are part of the adaptive immune system. They are…
Q: In the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain…
A: In this talk, we will learn about a very important experiment called the Avery, McLeod, and McCarty…
Q: Which is not a function of the subcutaneous fat layer of the skin? Which is not a function of the…
A: The subcutaneous fat layer, also known as the hypodermis, is a layer of adipose tissue that lies…
Q: Which of the following crosses, if any, would result in F1 genotypes and F2 genotypic and phenotypic…
A: The parental cross AAbb x aaBB results in F1 offspring that are all heterozygous for both genes…
Q: image of what a CT scan of an animal's abdomen looks like
A: Computed tomography (CT scans), is all examples of medical imaging technologies. Medical imaging is…
Q: A. Is A a chordate? [Select] B. Is A or B more Advanced? [Select] C. What evidence is there to…
A: Understanding the developmental connections among chordates is significant for decoding the…
Q: The energy released by each fission within the core of a nuclear reactor is 2.00 × 10² MeV. The…
A: Nuclear reactors are based on the principle of nuclear fission that releases heat and the hot steam…
Q: What important change happens to sperm in the female reproductive tract? a) The activation of…
A: Sperm capacitation is the process by which sperm undergo several changes in the female reproductive…
Q: newborn girl appeared normal at birth, but within 24 hours she developed lethargy, hypothermia, and…
A: Ornithine transcarbamylase deficiency is a rare genetic condition that causes ammonia to build up in…
Q: describe the process of sperm transport to the site of fertilisation and the changes which occur in…
A: Fertilization is the process by which a spermatozoon (sperm cell) fuses with an oocyte (egg cell),…
Q: Label the three following arrows and identify what the name of the whole specimen.
A: Plant kingdom is one of five kingdom which includes green , photosynthetic plants . It comprises…
Q: 5. On this replication fork, draw in all of the enzymes and proteins required for DNA replication…
A: Replication is crucial because it provides precise DNA duplication during cell division, enabling…
Q: global CO2 levels in the past million years were at or higher concentration that they are today…
A: Global warming is defined as the long term rise in temperature of the Earth's surface. The principal…
Q: Yeast cells are added to a 3.0 L batch bioreactor so that the initial cell concentration is [X]. =…
A: In this problem, we have a batch bioreactor containing yeast cells, ribose, and ammonia. The goal is…
Q: Which statement regarding carbon dioxide transport in the blood is true? HCO3-…
A: Carbon dioxide (CO2) transport in the blood refers to the process by which CO2 is transported from…
Q: please please answer super super fast and please please answer everything I would really appreciate…
A: This series of questions covers a variety of biological topics, such as the differences between…
Q: The fundamental axiom of preventive medicine suggests that: Select one: Oa. We should screen the…
A: The use of healthcare methods to prevent illnesses is known as preventive healthcare, sometimes…
Q: Is that the only correct option ?
A: In the nerve cells, the Na+ channels are most aggregated in the nodes of Ranvier regions (∼1000/µm2)…
Q: 6. What is a nosocomial infection? Which areas of the body/types of patients are most susceptible?…
A: Nosocomial infections, or hospital-acquired infections, are a significant concern in healthcare…
Q: The inheritance of one or more mutated genes can result in a genetic disease. Some genetic diseases…
A: Inheritance refers to the passing on of traits, characteristics or genetic information from parents…
Q: Which type of hormone requires a carrier protein in the blood? O Autocrine hormone Water-soluble…
A: A family of signalling molecules known as hormones are delivered from distant organs in…
Q: How is Sympathetic Afferent feedback carried in the a) upper pelvis?, and in b) the lower pelvis?
A: One of the three components of the autonomic nervous system, which controls bodily processes…
Q: Draw a diagram of the hormonal changes which occur during the menstrual cycle.
A: The menstrual cycle is the series of changes in hormone production, that has effect on female…
Q: This is a pedigree for a rare inherited disorder. What is the most likely mode of inheritance? I II…
A: Inherited disorder are caused by changes in certain genes or chromosomes that are transmitted from…
Q: The genotype of F₁ individuals in a trihybrid cross is AaBbCc. Assuming independent assortment of…
A: The given question is about trihybrid cross which means 3 different pairs of alleles representing 3…
Q: which plant family often has a basal rosette of leaves and a well-developed hypanthium?
A: Plant kingdom is one of five kingdom which comprises of green photosynthetic organisms. It includes…
Q: The total deviation is the: A. Treatment Deviation squared B Treatment Deviation + Unexpected…
A: Treatment deviation in biology experiments typically refers to the distinction or variance in the…
Q: Visible Growth in Tubes Growth in Petri Dishes 0 μg/ml 2μg/ml 0 + 1 2 + + + + 3 + 5 6 0000 a.…
A: The minimum inhibitory concentration (MIC) is the lowest concentration of an antimicrobial agent…
Q: Pick your favorite plant. Discuss the changes that will occur in the plant EITHER as it (a)…
A: The weeping fig (Ficus benjamina) is a popular houseplant and is known for its attractive glossy…
Q: A 1:2:1 genotypic ratio will occur when which of the following crosses is done?
A: The genetic complete genetic make up of an organisms is known as genotype.
Q: 5 2 4 3
A: Nervous system: It coordinates and controls the activities of animals and organisms. The central…
Q: Obj 29 Using the table of mRNA codons given below, identify the sequence of nucleotides in the mRNA…
A: CENTRAL DOGMA OF LIFE Replication: The process of formation of daughter DNA strands from parental…
Q: Which of the following statements is incorrect? a) Sperm occur as X- or Y-chromosome bearing…
A: This question is related to human reproductive biology and genetics. It tests the understanding of…
Q: All of the following are underlying causes of tropical deforestation EXCEPT: Question 24 options:…
A: Deforestation is the deliberate and permanent destruction of forests, usually by human activity. It…
Q: A patient’s GFR is 125 ml/min, and his urine is produced at a rate of 1.25 ml/min. (A) By what…
A: Glomerular filtration rate (GFR) is a measure of how well the kidneys are functioning. It represents…
Q: A mutation in the Pitx1 gene prevents development of pelvic spines in stickleback fish. Analyses of…
A: Mutations are changes that occur in the DNA sequence of an organism's genome. They can be caused by…
Q: describe how the oocyte prevents polyspermy
A: Polyspermy is a termed which is formed from combination of two words. One is 'poly' which means…
Q: 3. Which social behavior is exhibited in the picture below? Here is a pride of lions-three adults…
A: Social behavior Social behavior in animals refers to the interactions between members of the same…
Q: ow does the Toll-like receptor 4 signalling pathway work? Taking into consideration the cellular and…
A: Myeloid cells like erythrocytes, granulocytes and macrophages express toll like 4 receptors. These…
Q: Please label the following structures associated with the basal ganglia.
A: The forebrain's base and the midbrain's top are home to the basal ganglia. The brainstem, the…
Q: DATE 5/02/23 Law of Segregation of Alleles: As chromosomes separate into different gametes during…
A: Dihybrid cross involves the mating of individuals with varying traits for two characters. For…
Q: a. unwinds the DNA helix b. stabilizes and stops the two strands from annealing (rebinding with each…
A: DNA replication is the process by which a cell makes an exact copy of its DNA prior to cell…
Q: Below are data from a study of gas exchange physiology of three different breeds of domesticated…
A: In order to understand the quality of red blood cell in circulation, two parameters need to be…
Q: DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND…
A: During the process of transcription, one of the two DNA strands serves as a template for the…
What is the one-letter amino acid sequence formed from the following mRNA that codes for a pentapeptide that is an endorphin called Leu-enkephalin? 5' AUG - UAC - GGU - GGA - UUU - CUA - UAA 3'
Trending now
This is a popular solution!
Step by step
Solved in 5 steps
- What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Trp-Arg-Thr-Gin Ser-Trp-Arg-His-Trp-Ala-Lys Asp-Val-Ala-Ala-Lys Asn-Ser-Asn-Val-Ile-Arg The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Arg-His-Trp Arg-Thr-Gin Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp The original peptide sequence was: Asp-Val-Ala-Ala-Lys-Ser-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-His-Trp-Arg-Thr-Gin Asp-Val-Ala-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin-Ser-Trp-Arg-His-Trp-Ala-Lys Trp-Arg-Thr-Gin-Asn-Ser-Asn-Val-Ile-Arg-Ser-Trp-Arg-His-Trp-Ala-Lys-Asp-Val-Ala-Ala-Lys Arg-His-Trp-Arg-Thr-Gln-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Asp-Val-Ala-Ala-Lys-Ser-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp-Arg-His-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin…
- What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu synthetase, how will the following peptide sequence change upon mRNA translation? wild-type: Met-Lys-Leu-Pro-Ala-Leu-Val-Val-Ala O Met-Lys-Leu-Pro-Ala-Leu-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Val-Val-AlaIf methionine is the first amino acid incorporated into a heptapeptide, what is the sequence of the amino acids encoded for by the following stretch of mRNA? 5'-G-C-A-U-G-G-A-C-C-C-C-G-U-U-A-U- U-A-A-A-C-A-C-3'
- A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Ala Ser Glu-Met-AspLys Cys-His Ile His-Arg Thr-Trp Ala Ile-Phe-Asn-Arg Trp Cys–Cys–Gln The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Glu-Met-Asp Lys-Trp Asn-ArgAla Ser Cys-His-Ile-His-Arg-Thr-Trp Ala Ile-Phe Cys-Cys-Gin The original peptide sequence was:What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU -3' Express the sequence of amino axis's using the three-abbreviations, separate hyphens (e.g., Met-Ser-Thr-Lys-Gly).Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
- The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)