Which of the following is/are least likely to be found in an alpha helix?
Q: 18. In the following figure, structure C represents a , while structure F represents a Asparagine D…
A: The figure shows the process of translation.Translation is the process in which ribosomes in the…
Q: How are translation and transcription different?
A: Transcription is the way toward copying a gene DNA sequence to make a RNA molecule and translation…
Q: IV. Oswald Avery, McCarty and McLeod (Early 1940s) After Griffith's experiment most scientists…
A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…
Q: H 1. What type of DNA form (A-form, b-form, Z-form) is represented by the cyan strand in the image?…
A: Nucleic acids are genetic molecules that transfer and store information in cells at the molecular…
Q: The percentage of cytosine in a double-stranded DNA molecule is 40%. What is the percentage of…
A: Base pairs refer to the bases that form the double-stranded nucleic acids. This fundamental unit is…
Q: Distinguish DNA and RNA according to their structure and functions.
A: DNA & RNA are the nucleic acid found in living organism. DNA: Deoxyribonucleic acid RNA:…
Q: Which would be worse for an organism? Briefly explain your answer. B. The spliceosome can no longer…
A: Cell is the basic and fundamental unit of life. Survibility of life depend upon individual cells…
Q: 3. Understand Reverse/forwards strands and reverse complementary strand Example sequence…
A: Transcription is the process by which the nucleotide sequence of the DNA (deoxyribonucleic acid) is…
Q: AKS 5c1: Given the statements below, what is the correct sequence of events for protein synthesis? *…
A: Translation is the process of formation of a sequence of amino acid using messenger RNA as a…
Q: What is the nucleotide order in the complementary DNA strand? Your answer What is the nucleotide…
A: TEMPLATE STRAND - 5’-ATA CCC TCA CCT GGC AAT AAC TGT TCG GAT CAC GAG GGG CCA AAC CCT CTT TAC CAT ATA…
Q: 15 Which of the following amino acids would most likely be present in the boxed section, assume…
A: A protein is made of a polypeptide chain of amino acids and every amino acid is of different…
Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…
A: As per the guidelines we are supposed to answer only the first question in case of multiple question…
Q: which does not play a role in translation?
A: The translation is the process in which the message coded by an mRNA is translated into a sequence…
Q: An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed…
A: 21- nucleotide 22-spindle fibers 23- it directs the synthesis of protein 24-the complete…
Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…
A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…
Q: Describe the basic structure of a DNA? Give the different components of DNA and their function in…
A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…
Q: -Explain the a-helix and B-sheet structure of polypeptides.
A: Proteins are an important class of biomacromolecule. Proteins are made up of monomeric units called…
Q: During protein synthesis, which of the following are involved in the steps that take place in the…
A: Protein synthesis takes place via a process called translation . Before translation mRna have to be…
Q: How to transfer biological information in protein synthesis? What is the link between DNA and…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: 3. The chain of hemoglobin in man is 146 amino acids long. What would be the length in nucleotides…
A: Introduction :- Hemoglobin is a protein molecule found in red blood cells that transports oxygen…
Q: 1. Nucleotides make up DNA. List the three parts of a nucleotide. The three parts of a nucleotide…
A: As per our policy, We are answering only question 1. For the rest of the questions please repost.…
Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…
A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…
Q: 5. Match the description to the molecule(s). Each choice will be used only once. a. DNA b. mRNA C.…
A: All these terms are related to DNA, mRNA and tRNA. DNA stands for deoxyribonucleic acid. RNA stands…
Q: 10. Which of the following is not involved in the biosynthesis of a protein molecule? 1. Codon 2.…
A: Cellular organisms contain DNA in each and every cell which acts like a genetic information…
Q: Rank the following in terms of predicted rates: the nucleation of an a helix; the nucleation of a…
A: The β-sheet is a common motif of regular secondary structure in proteins. Beta sheet consists of…
Q: 4. Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…
A: Introduction : In sickle cell anemia, there is single nucleotide change within the gene. Thymine…
Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…
Q: Rank the following in terms of predicted rates: the nucleation of an α helix;the nucleation of a…
A: Given: Need to justify the nucleation of an α helix, parallel β sheet, antiparallel β sheet
Q: 13.1. A nucleotide consists of what three parts? 13.2. Draw a general nucleotide (see figure 3.31…
A: Nucleic acid is one of the classes of macromolecules that are present in all living things.…
Q: Many protein modifications take place in the endoplasmic reticulum (ER). Name one ER enzyme (and…
A: Note- frame the question correctly and repost it. Thank you!!
Q: question #3
A: Ribosomes are known as protein factories of the cell. They are of two types- 1. Prokaryotic…
Q: What item/s are true? 1. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND…
A: DNA and RNA are important for cell function as DNA provide the information for the cell's…
Q: When DNA replicates, how is it able to “unwind” its double helix?
A: DNA is able to unwind it's double helix with the help of enzyme DNA Helicase.
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: 4. Where are tRNA and mRNA made? 5. How many different amino acids are there in living organisms? 6.…
A: tRNA- it helps decode a messenger RNA sequence into a protein. mRNA-it is a single stranded RNA…
Q: 4. How is replication different from transcription in terms of product? 5. What do you call each…
A: DNA is the deoxyribonucleic acid which contains the genetic coding of an individual.
Q: C A T A C G C G T A с G
A: The given figure shows the process of DNA replication. DNA replication refers to the process of…
Q: 21. Know how to complete this and similar Tables. DNA т т т mRNA TRNA Amino Acids
A: The given table could be filled up by using the Watson-Crick base pairing rule and the codon table.…
Q: 1. When can a mutation on the DNA cause shortening of the translation product? Give a specific…
A: A single nucleotide or nucleic acid can be affected by a point mutation. When one base is replaced…
Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. Approximately what…
A: Answer - Option B - 8%
Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…
A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…
Q: 5. When can a mutation on the DNA cause shortening of the translation product? Give a specific…
A: Mutation is the phenomenon in which the DNA sequence is altered. This may occur spontaneously.…
Q: A proteins 3 structure will incorporate any 2 structure the protein has. One of 2 structure, the…
A: Two of the most common secondary structures exists in the proteins are α-helix and β-sheets. Most of…
Q: 2. Manufacturing biological molecules in the laboratory requires the use of relatively pure…
A: In a cellular compartment, the synthesis of biological molecules takes place in a series of steps…
Q: Which of the following carries amino acids?
A: Ribonucleic acid (RNA) is a single stranded nucleic acid found in all living cells. Its different…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 5 pts Question 9 95 58 40 HS HS SH 65 8 M urea and 72 B-mercaptoethanol 65 Hs84 Hs- SH 72 26 HS 110 SH 84 26 110 95 124 40 58 Native ribonuclease Denatured reduced ribonuclease Figure 2.53 Biochemistry, Seventh Edition O 2012 W. H. Freeman and Company The image above shows how Anfinsen unfolded ribonuclease for his classic experiment to see if proteins contain all necessary information for adopting their folded states on their own. To achieve proper refolding and ribonuclease activity, Anfinsen must have: trick question: ribonuclease cannot adopt its folded state without the help of cellular machinery removed the mercaptoethanol followed by the urea very carefully removed both the urea and mercaptoethanol at the same time removed the urea followed by the mercaptoethanolQuestion 9 Choose the CORRECT statement. O A polypeptide chain may have abrupt changes in direction and restriction in geometry because of the presence of glycine O A polypeptide chain may have abrupt changes in direction and restriction in geometry because of the presence of valine O A polypeptide chain may have abrupt changes in direction and restriction in geometry because of the presence of arginine O A polypeptide chain may have abrupt changes in direction and restriction in geometry because of the presence of prolineQUESTION 14 Identify the pictured nucleotide NH₂ N O 11 HO-P-O OH HO OH O Uracil monophosphate O Deoxythymidine monophosphate O Cytidine monophosphate O Deoxycytidine monophosphate
- Question 29 Which of the following statements is true regarding the formylmethionine that serves as the first amino acid in bacterial protein synthesis? A an aminoacyl-tRNA synthetase that is specific for formylmethionine attaches formylmethionine to the tRNA B the formyl group is removed during protein synthesis leaving methionine as the first residue in all bacterial proteins the formyl group donor is N¹0-formyl-tetrahydrofolate (D) the tRNA that carries formylmethionine is the same tRNA for methionineQuestion 11. // Hint: Isoelectric focusing separates proteins based on their pI values, and can separate proteins that only differ by a net charge of ±1.±1. Recall that an amino acid residue with a negatively charged R group has a relatively low isoelectric point (pI) where it has zero net charge. Likewise, an amino acid residue with a positively charged R group has a relatively high isoelectric point (pI) where it has zero net charge. Order from Low pH to High pHQuestion 14 The folding of an unfolded protein proceeds from low entropy disordered state to a single high entropy, low energy native conformation O True O False Question 15 The GroES subunit has 14 identical 549-residue subunits arranged in two stacked rings with 7 subunits eac True False
- Question 1.)Draw the main chain structure of a parallel beta sheet that has 4 amino acids in one strand and 5 in the other. Show all of the backbone atoms.Write R1, R2, R3, etc, instead of drawing side chains with the following exception: draw one proline in its entiretywith its side chain. You can put it anywhere in your sheet – I will find it. Add in all hydrogen bonds that stabilize this sheet using dashed lines.QUESTION 5 What is the amino acid attached to the tRNA with the following anticodon: CAG Glutamine Valine Aspartic Acid Proline None of the above Click Save and Submit to save and submit. Click Save All Answers to save all answers.Question 25 Calculate the net charges of the following peptides at pH 7.4. Indicate which amino acids bear chuarged side chans a) NH2-Asp-Leu-Phe-Ala-Lys-Pro-Glu-Gly-COOH b) NH2-GIn-Glu-Lys-Tyr-Trp-Arg-Ala-Leu-COOH DELL
- QUESTION 10 Select all of the true statements regarding the molecule below: NH, -P-O NH G OH NH, О-Р-О- H,N N- A ОН -P-O `NH U ОН 0-P-O- N' ОН ОН This is RNA This is DNA This chain is a polymer. The backbone of these nucleotides is a ribose sugar This nucleic acid is the hereditary material for humans. This nucleic acid is the hereditary material for coronaviruses. This type of nucleic acid is never found in healthy human cells. This nucleic acid contains the nucleobase thymine.QUESTION 4 Which of the following amino acids would stick to a CM-sepharose column at pH 7.07 Choose all that apply. Partial credit is allowed for each correct answer, arnd negative scores are allowed for incorrect answers. O Arginine (pl -10.76) O Glutamic acid (pl 3.22) O Cysteine (pl 5.07) O Histidine (pl 7.59)Question 4 a-D-galactose from B-D-glucose can be differentiated using which method of analysis? All of these Methylation analysis O Use of exoglycosidases NMR by the change in chemical shift