Which of the following sequences is less favorable to find in a folded beta? Select one: a.l-V-A-I-G-P-L-A-V-F-Y b. G-A-L-V-F-C-V-I-L-L-P E-V-A-I-I-F-M-D-G-V-A d. A-V-G-I-L-P-L-A-V-F-Y e.A-A-V-L-L-A-I-G-L-M-W c.
Q: Consider the reaction: H H₂C-(CH₂)C=C—C—SCOA H ➤ H3C- 13C-(CH₂) What kind of reaction is being…
A: The given structure is a fatty acyl Coenzyme A. Fatty acids are charged with acetyl CoA which are…
Q: I. Essay: Explain the following question with the use of illustrations. Briefly describe them with…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: The structure shown below iS: H HO CH₂OH -0 H OH H -H OH HOH₂C H 1 0 A) Sucrose 2ÍCH HỌ OB)…
A: The four types of biological macromolecules are nucleic acid, proteins, lipids and carbohydrates.…
Q: 1. Enzymes A) tilt the reaction equilibrium in favor of product formation B) tilt the reaction…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes…
Q: The amount of ATP that glycerol can produce is O less than 50% one glucase unit O 50% of one glucase…
A: Simple fat or triglycerides are fatty acid esters of glycerol. Glycerol is naturally occurring…
Q: Graph a double reciprocal plot that satisfy the following: a. Michaelis-Menten kinetics enzyme,…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: What's your next step to characterize this enzyme?
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: Signaling by tyrosine kinase receptors is generally associated with all of the following except: A)…
A: In contrast to G protein-coupled receptors where the cytosolic domain of the receptor is close to…
Q: In one to ten words answer questions (1) – (8) below. In short phrases answer questions (9) and (10)…
A: The secondary structure of proteins are spatial arrangement of the main chain atoms that make up the…
Q: The net energy requirement for translation of a 4 amino acid long polypeptide chain in terms of ATP…
A: The process of gene expression requires two steps, transcription and translation. During…
Q: The K of an enzyme is 5.0 mM. Calculate the substrate concentration when this enzyme operates at…
A: Km is the substrate concentration when the reaction rate is half the maximal rate. Thus, high Km…
Q: What are ketone bodies? How are they formed? What makes carboxylic acids acidic? Define the…
A: ketone bodies act as a source of energy under glucose and fat-deprived conditions. They are secreted…
Q: 1. Minor changes in primary structure can have pronounced effects on biological function. Tetrameric…
A: Hemoglobin is a tertameric protein made up of 4 subunits namely α2β2. The αβ form a dimer and 2 such…
Q: 3. Consider the reaction: H3C-(CH₂) H H C—C—C—SCOA HH H3C-(CH₂) a. What kind of reaction is being…
A: The given molecule is a fatty acyl CoA. Fatty acids are highly reduced and provide energy in the…
Q: A Class Il aminoacyl-tRNA synthetase installs the formyl-methionine on tRNAMet in bacteria. A…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Briefly describe the role and location of each cofactor/coenzyme involved in the pyruvate…
A: Pyruvate is the end product of glycolysis. Under aerobic conditions, pyruvate is oxidised into…
Q: The diagram below describes: A) How the pumping of sodium ions out of the cell can power the…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: From a kinetics experiment, Kcat was determined to be 55sec^-1. For the kinetic assay, 0.05mL of a…
A: The concentration of enzyme stock solution was 0.05mg/ml. i.e. 1ml contain 0.05mg of enzyme. We took…
Q: 5. Describe the role of His in the catalytic mechanism shown.
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Briefly describe the role and location of each cofactor/coenzyme involved in the pyruvate…
A: Pyruvate produced by glycolysis. Pyruvate Dehydrogenase Complex is a mitochondrial multiple enzyme…
Q: Some characteristics of three proteins are listed in the table below: Protein Molecular Weight (Da)…
A: Gel filtration chromatographic procedure in which the components are separated according to their…
Q: Provide the reagents used and the positive result to test the following nutrients
A: Nutrients are organic and inorganic substances needed by living cells to grow and survive. Some of…
Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: What is the smallest number of molecules of ATP and GTP consumed in the synthesis of a protein with…
A: The process of gene expression requires two steps: transcription and translation. Translation is the…
Q: Define optimum pH and temperature of an enzyme. 2. How do changes in pH and temperature affect the…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: a) What is the overall function of pyruvate carboxylase? b) Describe the role of each of the four…
A: (a) A metabolic enzyme called pyruvate carboxylase takes part in the first stage of gluconeogenesis.…
Q: 2. The mechanism of HMG-CoA reducatse enzyme activity involves several stages. For the catalytic…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Provide the name of the following nitrogen-containing heterocyclic base.
A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…
Q: For paper chromatography, the obtained Rf value of an amino acid with uncharged nonpolar R group is…
A: Chromatography is performed to separate a mixture of closely related substances. Paper…
Q: The following are coenzymes or cofactors involved in enzymatic reactions. Identify the biochemical…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: The primary structure of a protein describes Number of peptide linkages Sequence of the amino acid…
A: The protein structure is divided into four types. They are primary structure, secondary structure,…
Q: Which of the following can affect the binding of oxygen to hemoglobin? A) The pH of plasma B) The…
A: Hemoglobin is an essential component of the body. It is hemoglobin that is responsible for the…
Q: The Na-glucose symport system of intestinal epithelial cells couples the \"downhill\" transport of…
A: Recall that: The free energy for the transport of uncharged solute from a region where its…
Q: The iron (Fe) ion in the heme group of hemoglobin is bound to a: OA) Cystine B) Histidine C) Proline…
A: Our red blood cells (RBCs) are composed of hemoglobin that helps to transport oxygen throughout the…
Q: Consider the reaction: H3CC-CH₂-C—S-ACP OH H3CC-CH₂-C-S-ACP a. What kind of reaction is being…
A: Fats are highly concentrated stores of metabolic energy. Synthesis of fatty acids occurs in the…
Q: The highest level of structural complexity completely retained by the molten globule state of a…
A: Proteins are formed by the condensation of carboxyl group of alpha carbon of one amino acid with…
Q: Refer to the titration curve in answering the questions: 13 12 11 10 9 8 7 6 5 4 3 0 2 4 6 ← 8 10 12…
A: A titration curve is used to study the pH changes that occurs during the titration of an acid with a…
Q: The ff: table showed data of enzyme catalytic reaction. The rate of reaction (v) decreased with the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 1. I Draw the amino acids Asn and His and show the most prevalent interaction that would occur…
A: Asparagine is a polar uncharged amino acid, while histidine is a polar charged amino acid.…
Q: 1. Consider the reaction: succinyl-CoA succinate H3C H3C C H₂ a. What kind of reaction is being…
A: Acetyl CoA produced from fatty acid oxidation in the hepatic cells has two possible fates: enter…
Q: Explain how gluconeogenesis ang glucogenolysis are regulated to maintain blood glucose levels during…
A: Gluconeogenesis is the process of transformation of non-carbohydrate substrates ( lactate, amino…
Q: Provide the name of the following nitrogen-containing heterocyclic base. Z-I N A NH TU
A: The four major classes of biological macromolecules are nucleic acids, proteins, lipids and…
Q: Flippases help maintain membrane asymmetry. True False
A: Introduction Plasma membrane is he outer membrane of animal cell. Plasma membrane is composed of…
Q: Cells absorb water by osmosis, but plant cells and animal cells react differently to the influx of…
A: Introduction: The term osmosis refers to the movement of water molecules across a selectively…
Q: Proteins destined for the peroxisomes can be translocated in their functional shape. True False
A: Protein targeting is a biological process by which the cells localize the proteins in different…
Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…
A: The process of gene expression involves two steps: transcription and translation. Translation is the…
Q: 7. Imagine you're purifying a protein with a pl of 6.5 that has a 6-Histidine tag from E. coli…
A: Ni-NTA agarose is an affinity chromatography matrix that is used for the purification of recombinant…
Q: How much more does cytokine 2 gene expression change in severe COVID-19 patients than in mild…
A: Cytokine storm is the condition when various cytokines are expressed in very high levels. This cause…
Q: 3. In the experiment shown below, researchers looked at the effects of glucose-free medium on…
A: Glutamate is an amino acid that is synthesized from glutamine and through the transamination of…
Q: Zoey Wong is a research officer at the Department of Biosciences of Tunku Abdul Rahman University…
A: The basic principles of the central dogma of molecular biology is similar in both prokaryotic and…
Step by step
Solved in 2 steps
- Which of the following sequences is less favorable to find in a folded beta? Select one: a.I-V-A-I-G-P-L-A-V-F-Y b. G-A-L-V-F-C-V-I-L-L-P c. E-V-A-I-I-F-M-D-G-V-A d. A-V-G-I-L-P-L-A-V-F-Y e.A-A-V-L-L-A-I-G-L-M-WThe genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- Which of the ff is incorrect?A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyIf we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationWrite the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.Aa Po AaBbCcDc AaBbCcDdEe AaBbCcDdE AaBbCcDdE AaBbCcDdE BIUVab x, x A ev A 三==|這、|の Caption Emphasis Heading 1 Heading 3 Heading 4 Style Pane (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: Fo DNA only (D) TA2G – Completed forms must be available for Open Awards external moderation purposes. Page 6 of 15 > T | RNA only (R) Both DNA and RNA (B) Statement D or R or B Contains thymine Contains ribose Consists of two chains connected to each other with hydrogen bonds Has a sugar-phosphate backbone Has four different nitrogenous bases Contains a pentose sugar Is found in the nucleus and cytoplasm English (United Kingdom) Focus 目民 2490 words +1
- A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionwhat does the Hexa protein domain depict? (in relation with tay sachs disease)Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________