(4) A DNA strand is 5' TTCCGGAACTAG3' What is the sequence of opposite strand (Note if you write the strands using Courier New font, they will line up nicely)
Q: Using BME will disrupt which structures of a protein consisting of a single chain? Secondary,…
A: A protein is a large biological molecule made up of amino acid residues linked together by peptide…
Q: how to use valine in a 2 chemical equation involved in this experiment using the scheme below .
A: A method for separating and analyzing amino acids in a mixture is HPLC Ion Exchange Chromatography.…
Q: In a uni uni enzyme reaction, what is the substrate concentration relative to Km when an enzyme…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: What part of the cell is the molecule depicted below most likely to be located? cytoskeleton nuclear…
A: Lipids are a chemically diverse group of biomolecules that have two things in common:low solubility…
Q: What is the correct systematic name for the disaccharide below? Question 6 options: a…
A: Disaccharides are a class of carbohydrates that are made up of two monosaccharide units joined by a…
Q: Which model (2D topology or trRosetta) is likely a better representation of the actual protein AlaE,…
A: In the context of protein structure prediction, the posterior probability is generally considered a…
Q: Dihybrid Cross 13 Problem 5: A SsYy x ssyy test cross. Which of the following genotypes would you…
A: The objective of this question is to determine which genotype would not be expected in the offspring…
Q: What specific molecule gives rise to the stability and fluidity of the membrane and what are the…
A: The stability and fluidity of biological membranes primarily arises from the presence of…
Q: Why is it that the carboxylate "ions" actually partake in the citric acid cycle ratherthan the…
A: The regeneration of oxaloacetate from citrate is called the citric acid cycle. It occurs in the…
Q: Draw the major organic product of the following reaction. conc. KMnO4, heat
A: Answer is given below Explanation:
Q: The 4 kinase steps in glycolysis are catalyzed by hexokinase, phosphofructokinase, phosphoglycerate…
A: Glycolysis is a metabolic pathway, in which "Glucose" (six carbon sugar molecule) is broken down…
Q: a) Draw amino acid (L-Methionine) at low pH (pH= 1) b) Calculate the pl for amino acid Methionine
A: Isoelectric point is defined as the pH at which the amino acid exists as a zwitter ion. At this pH ,…
Q: Question 7 Listen a= albino A= Non Albino b=blond B=Dark Hair c=straight hair C=Curly Hair d-deaf D=…
A: The objective of this question is to calculate the probability of an offspring inheriting specific…
Q: Why standard samples such as blue dextran/K2Cr2O7 are needed in isolation of alkaline phosphatase?
A: Alkaline phosphatases (ALPs) are a group of isoenzymes situated on the outer layer of the cell…
Q: In the study by Amano et al. the authors developed a collection of RNA sequences that showed optimal…
A: Fibroblast growth factors (FGFs) are a family of signaling molecules crucial for various cellular…
Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…
A: Transition state theory states that as a substrate is converted into a product, a high energy state…
Q: SARS-CoV-2 Spike protein variant Wuhan Alpha Beta Delta Omicron KD, nM 60 9.6 2.4 1.2 2.4 Using the…
A: Consider a protein 'P' that can bind with 5 different ligands; L1, L2, L3 , L4 and L5.The…
Q: In what way are carbon-based compounds like children's Tinker Toys or Lego blocks? Give a few…
A: Carbon-based compounds are often compared to children's Tinker Toys or Lego blocks because carbon…
Q: 6. Use the density of water to determine the volume of water delivered. 7. Calculate the mean of…
A: In the given part 6to calculate the volume of water deliveredformula used= Density=…
Q: How does the predicted molecular weight of AlaE (16949.07) compare with the molecular weight of the…
A: SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…
Q: Enzymes are biological catalysts that decrease the activation energy necessary for a chemical…
A: Oxidoreductases are a class of enzymes that catalyze redox reactions. Oxidoreductases generally uses…
Q: 2) You are studying the tripeptide Lys-Val-Thr. a) Draw the full structure of the tripeptide…
A: Pepetides are composed of amino acids. Amino acids are biomolecules where a carbon atom (called…
Q: Cooperativity yields a sigmoidal kinetic curve. Which of the following is TRUE?
A: Co-operativity can be described as a phenomenon where the enzyme shape changes with the substrate…
Q: Genetics Question 16
A: The question is asking whether the number of chromosomes in the daughter cells produced at the end…
Q: Question 1: Look at table 17.2 to see the standard free energy changes for the steps in the CAC.…
A: Citric acid cycle is also called tricarboxylic acid cycle or TCA cycle or Krebs cycle. This is the…
Q: N - Leucine - Arginine - Proline - Aspartic acid - Methionine - C write the structure classify the…
A: Peptides are composed of amino acids that are bonded to each other via peptide bonds. The ionizable…
Q: The cell above is in a) Meiosis 2 b) Mitosis c) Meiosis 1
A: During anaphase II of meiosis:The sister chromatids, which were held together by cohesin proteins at…
Q: Week 8 Q2
A: The objective of the question is to explain how the chromosomal abnormalities XXY and YO can occur,…
Q: Considering PNPP → PNP reaction, would you expect to see more intense or pale color for the reaction…
A: para-Nitrophenylphosphate (pNPP) is a chromogenic substrate for phosphatases used in…
Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…
A: The objective of the question is to identify the substance that the Ringlemann scale is used to…
Q: Many pharmaceuticals exert their action by inhibiting the activity of enzymes. Choose the false…
A: Enzyme inhibition occurs when certain substances, called inhibitors bind to and inactivate enzymes.…
Q: . If 20 mM solution of Acetyl-phosphate is transformed to acetate by incubating with a catalytic…
A: Initially there was 20 mM acetyl-phosphate. At equilibrium, the acetyl-phosphate concentration…
Q: How many TCA cycles required to fully oxidize 1 molecule Acetyl-CoA. Support your answer with…
A: There are two oxidizable carbons in acetyl-CoA; the methyl carbon (CH3-) and the carbonyl carbon…
Q: GQ4
A: The objective of the question is to determine the number of possible gametes that an organism with 8…
Q: 3. The image below depicts 2,3-bisphosphoglycerate depicted in dark gray, and ß subunits are…
A: The objective of the question is to understand the role of 2,3-bisphosphoglycerate (BPG) in the…
Q: Do Km and Vmax get affected by available enzyme concentration? Explain.
A: Enzymes are proteins that catalyse biochemical reactions. Michaelis Menten postulated that free…
Q: What is the energy charge for the cell with concentrations of [ATP] = 1.000 mM, [ADP] = 10.00 uM,…
A: The energy charge, EC of a cell can be calculated using the formulaEC = [ATP + (1/2 ADP) ] / (ATP…
Q: Question 7
A: The question is asking about the capabilities of stem cells, specifically whether they can divide,…
Q: Question 1: Use this link to view Dr. Nicholson's metabolic pathways chart.…
A: Dr. Nicholson's Metabolic pathways chart is a map of an eukaryotic cell showing cellular locations…
Q: Dihybrid Cross Problem 7: Homozygous offspring of a dihybrid cross. In a dihybrid cross, AaBb x…
A: The objective of this question is to determine the fraction of offspring that will be homozygous for…
Q: 6. Discuss the potential contributions of ionic interaction, hydrogen bonds, hydrophobic…
A: Aspartic acid (Asp) contributes to ionic and hydrogen bonds, while hydrophobic and Van der Waals…
Q: You have a separate aqueous solution of the peptide DREAMY that is at a pH of 1.0. You then proceed…
A: pH = 1/log [H+]If [H+] concentration in a solution is high, pH will be low and the solution is…
Q: Make a figure that includes the hydropathy profile analysis, the TMHMM analysis and the TOPCONS…
A: The 3-D structure (topology) of transmembrane proteins can be studied with relative accuracy using…
Q: Which of the following is true of the difference between Class I and Class II B-lactamase…
A: Beta lactamase inhibitors are the substances or compounds that inhibit beta lactamase enzymes. Beta…
Q: You add 3.0 µg of plasmid DNA to a QIAprep spin miniprep purification column. You perform the…
A: Negative charge of silanol: A silica membrane is commonly seen in QIA prep spin mini prep…
Q: Describe the amino acid composition in terms of the general characteristics and comment on what the…
A: Proteins are made up of around 20 standard and a few non-standard amino acids. Depending on the…
Q: Draw the chain of atoms that are part of the covalent backbone that runs the length of the DNA…
A: DNA is composed of 2 polynucleotide strands. These DNA strands have a covalent backbone which is…
Q: 23. Calculate the free energy of hydrolysis ATP in a rat liver cell in which the ATP, ADP, and Pi…
A: The objective of this question is to calculate the free energy of hydrolysis of ATP in a rat liver…
Q: 1.0 0.9 Z 0.8 15. A pharmaceutical company studied the binding of three different compounds, X, Y,…
A: Compound Z has the strongest affinity for the protein. This is indicated by the higher fractional…
Q: 24. Hexokinase catalyzes the phosphorylation of glucose from ATP, yielding glucose-6-P and ADP. The…
A: The objective of the question is to calculate the standard-state free energy change and equilibrium…
Genetics Q4
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)
- If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?(üij If one of the strands of DNA has the following sequence of bases running in the 5' →3' direction 5'-G-G-A-C-A-A-T-C-T-G-C-3' 3'e c 4 GT TAGA C GS vhat base is 'closes: to 5' end in the compiementary strand?
- DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLYOne strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. 5'- What special type of sequence is contained in this DNA segment? Hoogsteen pairing major groove O palindrome mirror repeat What alternative structure does the double-stranded DNA have the potential to form? B-DNA O a G tetraplex triplex DNA a cruciform Z-form DNAHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
- Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'