Q: coagulates with antibody B only Blood type that agglutinates with Blood type AB if it becomes a…
A: Blood grouping is an important medical procedure to determine an individuals blood type. Blood type…
Q: Describe how the function of the vertebrate kidney has contributed to the success of vertebrates in…
A: The vertebrate kidney is a crucial organ that plays a significant role in the success of vertebrates…
Q: According to the optimal foraging theory, which of the following is NOT one of the factors that…
A: The optimal foraging theory is a widely accepted ecological theory that attempts to explain the…
Q: The diagram shows a simplified cross-section of a human body and an ultrasound transducer.. sto…
A: Ultrasound imaging technology is a widely used technology in medical science. It measures the…
Q: Several compounds are being developed as possible treatments for the cognitive defecits seen in…
A: Schizophrenia is a mental disorder characterized by cognitive deficits, including impairments in…
Q: What is the impact of small population size upon population genetics? Select an answer and submit.…
A: Population genetics is a branch of genetics that studies the genetic composition and changes in…
Q: In Pre RNA what do the uppercase letters and lowercase letters refer to?
A: The production of a chain of amino acids by using complementary base pairing between amino acids…
Q: Audrey is an 11-year-old child who exhibits repetitive behaviors and constantly repeats certain…
A: Neurodevelopmental disorders affect the development of proper nervous system that leads to abnormal…
Q: 1. What do you think would happen if the apical tip of each of these lateral shoots were now also to…
A: Plant hormones, also known as phytohormones are chemical messengers that regulate the growth,…
Q: What conclusions can you make regarding the changes to the ground squirrel population between 2000…
A: The Chi-Square test for Hardy-Weinberg equilibrium assumes the "null hypothesis" which can be…
Q: Reaction centers PSI and PSII are also called as per the wavelengths at which they have a maximum…
A: Photosynthesis is the process by which plants, algae, and some bacteria convert light energy into…
Q: Mutations cause variations among individuals. If these variations provide an advantage to…
A: The term "mutation" describes a shift or alteration in an organism's genetic code (DNA). Variables…
Q: Now cross two of the F₁ offspring. Parent 1 Od Br Gametes OR, Dr F2 Offspring Parent 2 Od hr Gametes…
A: A dihybrid cross, is a genetic cross involving two pairs of contrasting traits or alleles in…
Q: a) introns removed b) exons removed c) 5' cap added d) 3' cap added e) poly G…
A: Pre-mRNA (precursor mRNA) is the initial RNA transcript that is synthesized by RNA polymerase II…
Q: In the picture below, the indicated genes are linked, but not syntenic. Gene 14 15 Gene 20
A: A gene is the unit of heredity of a living organism. It can be also defined as a region of genomic…
Q: Since the above Alu sequence used to code for a functional protein in the past, but no longer codes…
A: Alu elements are short stretches of nearly conserved nucleotide sequences present in multiple…
Q: In what type of muscle would the structure illustrated in the image at right be found? A. The flight…
A: Caenorhabditis elegans, a species of roundworm known as a nematode, is frequently used as a model…
Q: Discuss the stages of the secretory pathway
A: The secretory pathway is a series of membrane-bound compartments that are involved in the…
Q: Will Beta-lactam antibiotics disrupt cell wall formation in Domain Archaea? • A. No as Archaea do…
A: Antibiotic is an anti-microbial substance which kill or restrict microbial growth. Their…
Q: What is the difference between retinal, opsin, and rhodopsin?
A: Most vertebrates have two photoreceptor cells that are involved in vision. These cells are described…
Q: What is the function of antidiuretic hormone? Group of answer choices 1. It increases the…
A: ADH, also referred to as vasopressin, is a hormone that the hypothalamus produces and the posterior…
Q: A backyard homesteader that wants to expand the amount of cute duck breeds. They know the f gene…
A: The recombination frequency is the frequency which involves the single chromosomes crossing between…
Q: Connective tissue sheath surrounding individual muscle fibers (Endomysium) Bundle of muscle cells…
A: Muscle is a type of tissue in the body that is composed of cells called muscle fibers or myocytes.…
Q: After comparing the whole genome sequencing results from a candidate that you suspect has a mutation…
A: A missense mutation is a type of genetic mutation that results in the substitution of one nucleotide…
Q: Suggest roles for leptin in the ovaries and testes
A: A hormone is a chemical messenger produced by glands in the endocrine system that regulates various…
Q: Can you find any basis for justifying the practice of FGM ( women genital multilation )? Are there…
A: FGM stands for female genital mutilation, which is a harmful practice that involves the partial or…
Q: Why is sexual reproduction still around? (Choose all that apply) fitness of the population populates…
A: Reproduction is a process where new offspring is produced, it mainly has two types sexual…
Q: What are the results of looking at the pure cultures of S.aureus on Baird Parker agar Cl.…
A: Differential media are forms of culture media that are intended to separate various microorganism…
Q: Homework: Chose a waste sector, i.e. domestic, industrial, or agricultural... Quantify the type and…
A: The waste sector is related to the following inquiries in various contexts, with a special emphasis…
Q: When an antigen enters the bloodstream, it triggers ____________________ Question 7 options:…
A: Antigens are molecules that the body recognises as non-self or foreign. They can be found on the…
Q: 1. When intraoral radiographs are taken, the bisecting angle technique is used to assess ___ and…
A: Tooth extraction is a common dental procedure, but it still carries potential risks and…
Q: Describe the genetic and environmental conditions that may lead to the onset of Type 1 Diabetes…
A: INTRODUCTION Type 1 diabetes mellitus is a chronic autoimmune disease in which the immune system…
Q: Match the structures on the left to the categories on the right. Stem Shoot Radicle Hypocotyl…
A: Plants are necessary for life on Earth because they provide oxygen and food and materials. They are…
Q: Describe the structure of myosin molecules and their in a thick filament; also describe the of a…
A: Muscle contraction is a complicated process involving the coordinated interaction of several…
Q: According to the Fick equation, the fish gill is an effective gas exchange surface because... A. It…
A: The Fick equation is a mathematical formula that describes the rate of diffusion of a gas across a…
Q: Assume that a sibling sought your advice as a Proband. Acting as a genetic counselor for your own…
A: There are different inheritance pattern that a pedigree could follow. These inheritance pattern…
Q: 10. Passive transport: a. occurs from regions of low to high concentration. b.…
A: Transport refers to the movement of substances such as molecules or ions, into, out of or within…
Q: Give typed full explanation Introduction of induction of specific protective antibodies in a…
A: Immunity refers to the ability of an organism to resist or defend against a particular infection or…
Q: 3. The envelope of a flu virus helps the virus open and enter the cell and insert its DNA into the…
A: A variation in an organism's genome's DNA sequence is referred to as a mutation in the field of…
Q: You add a drug to your bacterial culture that disrupts the proton motive force (movement of protons…
A: The proton motive force (PMF) is a mechanism used by cells, particularly prokaryotic and plant…
Q: Which of the following statements about metabolic heat is true? A. Relative to their body size,…
A: The heat produced as a byproduct of metabolic processes occurring within living organisms is known…
Q: You are confronted with two creatures that, on first glance, both appear to be pill bugs. Upon…
A: Pill bug is an isopod crustacean and is relative of shrimp and cray fish. It belongs to phylum…
Q: What determines the specificity of viruses to their host cells? a. surface or outer proteins b. No…
A: A virus is a microscopic infectious agent that can infect living organisms such as animals, plants,…
Q: Please name the differences between competitive and noncompetitive inhibition.
A: Enzyme inhibition is a process that can occur in biochemical reactions, where a molecule binds to an…
Q: 4. Cystic fibrosis is a homozygous recessive condition that affects 1 in 10,000 of the Hispanic…
A: The Hardy-Weinberg principle is a fundamental concept in population genetics that describes the…
Q: Give a lab report introduction. introduction should include a general background on bacteriophages,…
A: A bacteriophage, also known as a phage, is a type of virus that infects and replicates within…
Q: b. 36 ATP only when O2 is used during this process c. 2 ATP in both aerobic and…
A: (Note: As per Bartleby Guidelines only 1 of the 3 questions will be answered. Please post remaining…
Q: 1. Name the two types of structures that mediate cell-cell contact and are associated with…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Atrial natriuretic peptide has been found to Group of answer choices 1. inhibit sodium reabsorption…
A: A hormone is a chemical messenger produced by specialized cells or glands in the body that is…
Q: Match the biochemical test mediums to the chemical components for test reaction: OTSI TSI and SIM…
A: Biochemical test media are specialised growth mediums created to promote the growth and metabolic…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Translate the following mRNA transcript
5’CGCCGAUGCGCGAUAUGUGGUAA’3
A. RRCAICG
B. ADARYVV
C. MRDMW-
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.give the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
- Which of the following represents the sequence of an RNA transcript for which the template strand of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. DA. GUACUGGCUAGCUGCUAGAA B. UUCUAGCAGCUAGCCAGUAC с. ТТСТАGCAGCTAGCCAGTАС D. GTACTGGCТAGCTGCTAGAАConsider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
- Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G