Q: Why are men more prone to hemophilia than women? Elaborate.
A: Hemophilia is a disorder related to blood that causes blood to clot improperly. A deficiency of coag...
Q: Virology: What is a benefit of classifying viruses?
A: Introduction :- A virus is a small collection of genetic code, either DNA or RNA, surrounded by a pr...
Q: In lilies, large lilies are dominant to small ones and green ones are dominant to white ones. You cr...
A: Introduction: Mendel's law of independent assortment: When one allelic gene pair segregates then se...
Q: Define the Regulation of gene expression in bacteria ?
A: All the cells contain genes in them. Genes carry the information on hereditary material. Genes are p...
Q: A. Entamoeba hartmanni B. Entamoeba coli C. Entamoeba polecki
A: Note: As Per Guidelines, We Can Answer One Question or 3 subparts per question. Ask Again To get res...
Q: Do you beleive that humans evolve from apes? If so why are there is still apes?
A: No, i don't believe humans evolved from apes. Humans evolved alongside of apes.
Q: The inferior colliculi are involved in the startle response to loud noises. O True False
A: The pathway conveys the special sense of hearing. Information travels from the receptors in the org...
Q: 3. A woman has a rare abnormality of the eyelids called ptosis, which makes it impossible for her to...
A: Gene expression is the mechanism through which genetic code is used to create a functioning gene pro...
Q: What are long terminal repeat (LTR) ?
A: Long terminal repeat are repetitive sequence of DNA found at the end of pro-viral DNA after reverse ...
Q: In order to determine whether DNA or protein is the genetic material, can the following isotopes be ...
A: Introduction: The search for genetic material is a very long story. it took a long to be discovered ...
Q: Fatty acids in phospholipids and triacylglycerols interact with one another by (a) disulfide bridges...
A: The correct answer to the above question is e. Fatty acids in phospholipids and triacylglycerols do ...
Q: Please answer fast How is electron transport coupled to proton efflux by complex I of the respirato...
A: The electron transport chain and oxidative phosphorylation are coupled by a proton gradient across t...
Q: Covid-19 variants is an example of evolution in response to environmental change. Using another exam...
A: Introduction :- Evolution is defined as the descent with modifications . It is a continuous and grad...
Q: Occasionally an ectopic pacemaker will develop in part of the conducting system of the heart. What h...
A: An ectopic pacemaker is a collection of excitable cells located outside of the heart's typically ope...
Q: Identify the monomers for the following polymers A.) Maltose B.) Sucrose C.) Lactose
A: INTRODUCTION The monomer of the polymers is given below.
Q: You can drink 12 Pabst Blue Ribbon beers at the biker bar that you hang out in every day without fee...
A: Option (b) Cross tolerance
Q: Which sense do Lemurs rely on that monkeys do not? How many species of lemurs live on Madagascar? Ho...
A: Lemurs are primates belong to superfamily Lemuroidea.
Q: Give the methods of transposition ?
A: Deoxyribonucleic acid or DNA is a hereditary material that transfers from one generation to another....
Q: Which of the following predictions does neutral theory make? all loci are equally constrained in the...
A: According to the neutral theory of molecular evolution, the majority of evolutionary changes occur a...
Q: I have parallel leaf veins, flower parts in 3 and a fibrous root system. What am I? Group of answer ...
A: Monocots contains single cotyledon, parallel-veined leaves, scattered vascular bundles in the stem,...
Q: Question 31 Choose the answer with the events involved in transduction in the corre 1. A transducing...
A: Transduction can be defined as a one of the method of genetic recombination;in which the genetic mat...
Q: What is NOT true about epithelial tissue? A. epithelial cells are only found on the outside integume...
A: There are four different types of tissues in human body, Epidermal tissues Connective tissue Nervo...
Q: Because the brain loses the ability to create new neurons very early in a person's development, neur...
A: The neural cells or the neurons present in the brain can not be replaced once damaged in adulthood a...
Q: Discuss the pathophysiology of Chronic Kidney Disease (CKD).
A: A disease is a distinctly abnormal condition that negatively affects the structure or capacity of al...
Q: There is an outbreak of food poisoning at a local restaurant. The patrons present with 24 hours of v...
A: DISCLAIMER : Since you have asked multiple question, we will solve the first question for you. If yo...
Q: Question 3.Which of the following statements about the Na*/K*-ATPase pump is true? A. It is a protei...
A: Like the sun is the source of all energy on the earth, cells are the basic units of life. All organi...
Q: . A corn geneticist has three pure lines of genotypes a/a ; B/B ; C/C, A/A ; b/b ; C/C, and A/A ; B/...
A: Genetics is a part of science that deals with the investigation of genes, genetic variation, and her...
Q: Salamanders can regenerate limbs, but only under certain conditions. Kindly answer the following que...
A: Answer: As a multipart question is asked here and we can answer only 3 subparts so providing here th...
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is...
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts f...
Q: Description of
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: What are dyneins?
A: Cells are the fundamental unit of life. They are the foundation of all life forms. Cells have certai...
Q: proteins are embedded within a membrane.
A: A cell's plasma membrane is a lipid bilayer. It isolates the components of a cell from their surroun...
Q: Please label the following:
A: 1)Pareital pericardium 2)Right ventricle 3)Right coronary artery and cardiac vein 4)Right atrium ...
Q: Imagine a bird species in which many individuals spend their first summer of adulthood helping other...
A: answer is a
Q: Referring back to the quaternary level proteins, list and describe the modifications that can be mad...
A: The structure of protein includes sequence of amino acids in a polypeptide chain. The formation of t...
Q: How does your excretory system help you maintain homeostasis when you are dehydrated? 2) Structu...
A: The kidneys can regulate water levels in the body; they conserve water if you are dehydrated, and th...
Q: Imagine Cas9 used a 30 base RNA molecule instead of a 20 base molecule. How often will it cut? Hint:...
A: Compared to previous techniques for modifying DNA or RNA, this new approach is much faster and easie...
Q: explain why spherocytes and sickle cells will decrease the ESR. Your answer
A: The fluid in the body that delivers oxygen and nutrients to the cells, as well as removes metabolic ...
Q: What type of trait and genetic interactions are shown below? Environment Gene 1 Phenotype Gene 2 Gen...
A: Option c
Q: Which statement about integument tissues is NOT TRUE? Group of answer choices A. Turtle skin is actu...
A: A- Is not true:- Rather the shell is part of the turtle's body and is made of bones, collagen, skin,...
Q: Answer Question 1,2 and 3 1. What is a feces? 2. What is the meaning when you place the strip of lit...
A: ''Answer-A solid residue or a semi-solid remain of undigested food that is not digested in the small...
Q: Some prokaryotes are Chemoheterotrophs. Where do these organisms get their energy from? Group of ans...
A: According to the question, Some prokaryotes are Chemoheterotrophs. Now, we have to find out from wh...
Q: How do we know that DNA repair mechanisms detect and correct the majority of spontaneous and induced...
A: Introduction: When it comes to its base makeup and DNA sequence, the genetic macromolecule known as ...
Q: a-helical
A: The alpha helix is the secondary structure of proteins and is a right hand-helix conformation in whi...
Q: Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel synth...
A: A gene can be described as the complete set of genetic data present in an organism. This data is ass...
Q: 2. In tomatoes, 2 pairs of genes affect the phenotypes of ripe fruit with the following alleles. R= ...
A: Answer - A) Rroo x rrOo Rr rr oo Rroo rroo Oo RrOo rrOo The phenotypic ratio of the giv...
Q: 2. In tomatoes, 2 pairs of genes affect the phenotypes of ripe fruit with the following alleles. R =...
A: Genotype is the genetical makeup of the organism for suppose TT tall trait, Tt heterozygous tall. Tt...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Q: Which of the following are arguments against the expression "survival of the fittest"? Choose all th...
A: "Survival of the fitness"is a phrase which become famous in On the Origin of Species of Charles Darw...
Q: Peptidoglycan is composed of: Strands of repeating subunits of G and M with a short stem peptide lin...
A: Given: Bacterial cell wall is made up of Peptidoglycan.Bacterial cell wall provides structure and sh...
What is the biology of Schizophrenia ?
Step by step
Solved in 2 steps with 2 images
- What is the pedigree analysis of schizophrenia?Do the course and outcome of Schizophrenia differ from country to country ?A fuller recovery from schizophrenia is more likely among individuals who display all of the following characteristics EXCEPT: A) the onset of the disorder was very rapid B) onset of the disorder was triggered by stress C) experienced earlier onset of the disorder D) showed high levels of functioning prior to onset of the disorder
- According to the neurodevelopmental hypothesis, when do the brain abnormalities associated with schizophrenia originate?Which of the following symptom pairs include both a positive AND negative symptom of schizophrenia? Question 45 options: a) Poverty of speech; lack of initiative b) Anhedonia; flat affect c) Erotomania; social withdrawal d) Avolition; reduced hygieneExplain the cause for risk for schizophrenia ?