Concept explainers
(a)
To determine: A model which explains the functioning of RecBCD enzyme complex at the time of genetic recombination of bacteria.
Introduction: Bacterial cells undergo the process of genetic recombination to exchange their genetic material by different types of pathways. These pathways require RecA protein in different sets in all these pathways for catalyzing strand invasion.
(b)
To determine: The modified model that explains about the co-infection of bacterial cells and mutated bacteria with two different strains of bacteriophage in which genes recombine at a different level of frequencies near their CHI sites.
Introduction: Bacterial cells undergo the process of genetic recombination to exchange their genetic material by different types of pathways. These pathways require RecA protein in different sets in all these pathways for catalyzing strand invasion.
Want to see the full answer?
Check out a sample textbook solutionChapter 25 Solutions
Becker's World of the Cell (9th Edition)
- Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.arrow_forwardPstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardTyr- The starting substrate and active site of a Type I topoisomerase is shown below. During this reaction, a small molecule is introduced that removes free hydroxyl groups from DNA (but not protein). Please draw the resulting product under these conditions, including the arrow pushing mechanisms that lead to the product(s). s' CH₂ DNA Base O 111110 H CH₂ Basearrow_forward
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardPart I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forward
- gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardBroken operators. Consider a hypothetical mutation in OR2OR 2 that blocks both A repressor and Cro binding. How would this mutation affect the likelihood of bacteriophage entering the lytic phase?arrow_forward
- How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning