Microbiology: An Evolving Science (Fourth Edition)
4th Edition
ISBN: 9780393615098
Author: John W. Foster, Joan L. Slonczewski
Publisher: W. W. Norton & Company
expand_more
expand_more
format_list_bulleted
Question
Chapter 25.5, Problem 1TQ
Summary Introduction
To review :
The derivation of protein secretion system from a DNA (deoxyribonucleic acid)-pumping system.
Introduction:
Bacterial secretion system refers to the secretion system of bacteria that gives the pathogenic bacteria a peculiar mechanism of virulence. It helps them to bypass the external cellular environment and inject their bacterial effector proteins directly into the host cell. The secretory systems are categorized on the basis of specific structure, activity, and composition.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider an animal. During DNA replication, all base pairs of DNA are copied. But, during transcription, only some of the DNA bases are transcribed. What parts of the DNA or/and protein(s) determines which part of the genome is transcribed into mRNA? (short answer)
The role of GTP hydrolysis in actin polymerization is similar to the role of ATP hydrolysis in tubulin polymerization: both serve to weaken the bonds in the polymer and thereby promote depolymerization. Is that true or false? why?
Protein 2:
DNA
AGAGTTCTGCCCTGTCGATTT
MRNA
Amino Acid
Sequence
1. Which kind of protein molecule did this gene make?
2. How does this protein help the body maintain homeostasis?
Chapter 25 Solutions
Microbiology: An Evolving Science (Fourth Edition)
Ch. 25.1 - Prob. 1TQCh. 25.4 - Prob. 1TQCh. 25.4 - Prob. 2TQCh. 25.4 - Prob. 3TQCh. 25.4 - Prob. 4TQCh. 25.5 - Prob. 1TQCh. 25.6 - Prob. 1TQCh. 25.6 - Prob. 2TQCh. 25.6 - Prob. 3TQCh. 25.6 - Prob. 4TQ
Ch. 25.7 - Prob. 1TQCh. 25 - Prob. 1RQCh. 25 - Prob. 2RQCh. 25 - Prob. 3RQCh. 25 - Prob. 4RQCh. 25 - Prob. 5RQCh. 25 - Prob. 6RQCh. 25 - Prob. 7RQCh. 25 - Prob. 8RQCh. 25 - Prob. 9RQCh. 25 - Prob. 10RQCh. 25 - Prob. 11RQCh. 25 - Prob. 12RQCh. 25 - Prob. 13RQCh. 25 - Prob. 14RQCh. 25 - Prob. 15RQCh. 25 - Prob. 16RQCh. 25 - Prob. 17RQCh. 25 - Prob. 1TQCh. 25 - Prob. 2TQCh. 25 - Prob. 3TQCh. 25 - Prob. 4TQCh. 25 - Prob. 5TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- This activity breaks down protein synthesis using the metaphor of PIZZA! Use your Amino Acids Reference Sheet to complete the following table. Fill in the blank spaces of each row with either the missing DNA triplet, the mRNA codon, or the Amino Acid. While there are actually multiple codons that code for any one amino acid, for this activity there only needs to be one DNA triplet and one corresponding mRNA codon recorded for each amino acid. Remember: RNA uses uracil (U) instead of thymine (T)! TTG GGG CGT AAA TTT CAA DNA AAC UAU CAC GCA AAA mRNA codon Asparagine Proline Tyrosine Amino Acid Histidinearrow_forwardThe antibiotics puromycin and erythromycin are known inhibitors of protein synthesis. (a) Which part of the protein synthesis is affected by each antibiotic? (b) What could be the reason why one of them is more effective than the other one when they are given in the same dose? No plagiarism please. No copy paste. Use own words. Thanks.arrow_forwardWhy siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking protein translation Because specific gene silencing leads to blocking mRNA transcription Because specific gene silencing leads to blocking DNA replication All answers are correctarrow_forward
- Protein synthesis occurs in all living cells. Why, then, are some antimicrobial drugs that target protein synthesis selectively toxic to bacteria? The protein synthesis in human cells will only occur inside the nucleus. The ribosomes found in human cells and those found in bacterial cells have different structures. Protein synthesis in bacteria is completed by ribosomes, while protein synthesis in humans is completed by polymerase enzymes. The protein synthesis in human cells occurs less frequently than that in bacterial cells.arrow_forwardPlease help me with this question. More than one answer may be correct. The cis golgi compartment ______. Options: A) is a convenient place to store tools in small cars. B) uses clathrin as a coating protein to send vesicles to the medial compartments. C) sends proteins to their proper destination. D) is continuous with the trans compartment. E) adds specific signal to proteins destine for the lysosomes.arrow_forwardExplain the binding problem.arrow_forward
- ..You have isolated a new protein called STICKY. You can predict from comparisons with other known proteins thatSTICKY contains a bHLH domain.Predict the function of STICKY and rationale for the importance of these domains in STICKY function.. ..arrow_forwardWhich is NOT a true difference between messenger RNA and DNA? (i.e., which of the following statements is false?) DNA remains in the nucleus (except when the nuclear envelope breaks down during mitosis), whereas mRNA is never in the nucleus; it is always in the cytoplasm. A DNA molecule has a longer life span than a typical molecule of RNA. DNA has thousands of genes; mRNA is usually a copy of just one gene. DNA has thousands of genes; mRNA is usually a copy of just one gene.arrow_forwardProtein synthesis is energetically expensive. Consider the hydrolysis of ATP into AMP as equivalent to 2 ATP, and both ATP and GTP as energetically equivalent. In a cell-free system, how many ATP equivalents are required to incorporate 32 amino acids into a growing peptide chain?arrow_forward
- Describe translation. What is the function of the aminoacyl-tRNA synthase?arrow_forwardUsing the the enzyme acid hydrolase in the lysosome: What is the final destination in which the protein will function? Which features will the protein receive during its manufacture? What is the primary structure (general)? Where is the primary structure made? Where are the secondary and tertiary structures made? Will the protein travel through any organelles during its manufacture? Which ones? What would be the overall result if some part of the manufacture process went wrong, such that the protein ended up as nonfunctional?arrow_forwardX Protein production takes place in the cytoplasm. in the nucleolus. outside the cell. in the Golgi apparatus. in the nucleus.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY